EMAIL THIS PAGE TO A FRIEND

DCDC2B

doublecortin domain containing 2B

35 Gene Product Result for
UniProtKB ID: A2VCK2, B7ZBC6
Gene ID:
Human(149069) Summary: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. [provided by RefSeq, Sep 2010]
Mouse(100504491) doublecortin domain containing 2b
Rat(682416) doublecortin domain containing 2B
sheep(101116209) doublecortin domain containing 2B
domestic guinea pig(100729917) doublecortin domain containing 2B
naked mole-rat(101712042) doublecortin domain containing 2B
Zebrafish(563259) doublecortin domain containing 2B
domestic cat(101081237) doublecortin domain containing 2B
cow(514470) doublecortin domain containing 2B
dog(611856) doublecortin domain containing 2B
chicken(770841) doublecortin domain containing 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099434 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099434 Rosetta Predictions human pricing
XM_926306 Rosetta Predictions human pricing
XM_001061422 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320719 predicted 761
2 SASI_Hs02_00320720 predicted 563
3 SASI_Hs02_00320721 predicted 481
4 SASI_Hs02_00320722 predicted 221
5 SASI_Hs02_00320723 predicted 927
6 SASI_Hs02_00320724 predicted 1074
7 SASI_Hs02_00320725 predicted 841
8 SASI_Hs02_00320726 predicted 380
9 SASI_Hs02_00320727 predicted 290
10 SASI_Hs02_00320728 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266107 predicted 772
2 SASI_Hs01_00266108 predicted 255
3 SASI_Hs01_00266109 predicted 567
4 SASI_Hs01_00266110 predicted 487
5 SASI_Hs01_00266111 predicted 221
6 SASI_Hs01_00266112 predicted 232
7 SASI_Hs01_00266113 predicted 839
8 SASI_Hs01_00266114 predicted 378
9 SASI_Hs01_00266115 predicted 802
10 SASI_Hs01_00266116 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300054 predicted 417
2 SASI_Rn02_00300055 predicted 610
3 SASI_Rn02_00300056 predicted 493
4 SASI_Rn02_00300057 predicted 279
5 SASI_Rn02_00300058 predicted 394
6 SASI_Rn02_00300059 predicted 510
7 SASI_Rn02_00300060 predicted 527
8 SASI_Rn02_00300061 predicted 255
9 SASI_Rn02_00300062 predicted 220
10 SASI_Rn02_00300063 predicted 255
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099434
DCDC2B MISSION shRNA Bacterial Glycerol Stock
doublecortin domain containing 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-839s21c1
Sequence:CCGGCATTCCCATCAGGAGTTATAGCTCGAGCTATAACTCCTGATGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-226s21c1
Sequence:CCGGCAGTATGTGGCCGCTGGATTTCTCGAGAAATCCAGCGGCCACATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-253s21c1
Sequence:CCGGTTCCACAAGCTCCACTATTTACTCGAGTAAATAGTGGAGCTTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099434.1-1080s21c1
Sequence:CCGGACCACTACTCTGGCCACCTTTCTCGAGAAAGGTGGCCAGAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-572s21c1
Sequence:CCGGTGGTAACTGGCCATTACTATGCTCGAGCATAGTAATGGCCAGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099434
DCDC2B MISSION shRNA shRNA Plasmid DNA
doublecortin domain containing 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-839s21c1
Sequence:CCGGCATTCCCATCAGGAGTTATAGCTCGAGCTATAACTCCTGATGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-226s21c1
Sequence:CCGGCAGTATGTGGCCGCTGGATTTCTCGAGAAATCCAGCGGCCACATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-253s21c1
Sequence:CCGGTTCCACAAGCTCCACTATTTACTCGAGTAAATAGTGGAGCTTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099434.1-1080s21c1
Sequence:CCGGACCACTACTCTGGCCACCTTTCTCGAGAAAGGTGGCCAGAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-572s21c1
Sequence:CCGGTGGTAACTGGCCATTACTATGCTCGAGCATAGTAATGGCCAGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099434
DCDC2B MISSION shRNA Lentiviral Transduction Particles
doublecortin domain containing 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-839s21c1
Sequence:CCGGCATTCCCATCAGGAGTTATAGCTCGAGCTATAACTCCTGATGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-226s21c1
Sequence:CCGGCAGTATGTGGCCGCTGGATTTCTCGAGAAATCCAGCGGCCACATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-253s21c1
Sequence:CCGGTTCCACAAGCTCCACTATTTACTCGAGTAAATAGTGGAGCTTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099434.1-1080s21c1
Sequence:CCGGACCACTACTCTGGCCACCTTTCTCGAGAAAGGTGGCCAGAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099434.1-572s21c1
Sequence:CCGGTGGTAACTGGCCATTACTATGCTCGAGCATAGTAATGGCCAGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks