EMAIL THIS PAGE TO A FRIEND

DCHS1

dachsous 1 (Drosophila)

Synonyms: CDH25 CDHR6 FIB1 PCDH16
UniProtKB ID: Q96JQ0, O15098
Gene ID:
Human(8642) Summary: This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
Mouse(233651) dachsous 1 (Drosophila)
Rat(308912) dachsous 1 (Drosophila)
chicken(419073) dachsous 1 (Drosophila)
domestic cat(101093545) dachsous 1 (Drosophila)
cow(515576) dachsous 1 (Drosophila)
Horse(100055264) dachsous 1 (Drosophila)
dog(476837) dachsous 1 (Drosophila)
domestic guinea pig(100733667) dachsous 1 (Drosophila)
naked mole-rat(101707793) dachsous 1 (Drosophila)
sheep(101109908) dachsous 1 (Drosophila)
Domestic Rabbit(100357034) dachsous 1 (Drosophila)
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003737 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003737 Rosetta Predictions human pricing
NM_001107544 Rosetta Predictions rat pricing
XM_194371 Rosetta Predictions mouse pricing
XM_982545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336190 predicted 8101
2 SASI_Hs01_00036507 predicted 4264
3 SASI_Hs01_00036508 predicted 6065
4 SASI_Hs01_00036509 predicted 1471
5 SASI_Hs01_00036510 predicted 8419
6 SASI_Hs02_00336191 predicted 3935
7 SASI_Hs01_00036511 predicted 2924
8 SASI_Hs01_00036512 predicted 2611
9 SASI_Hs01_00036515 predicted 8181
10 SASI_Hs02_00336192 predicted 3176
11 SASI_Hs01_00036506 predicted 3891
12 SASI_Hs01_00036513 predicted 2413
13 SASI_Hs01_00036514 predicted 3604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229875 predicted 2277
2 SASI_Rn02_00229876 predicted 6253
3 SASI_Rn02_00229877 predicted 1957
4 SASI_Rn02_00229878 predicted 3822
5 SASI_Rn02_00229879 predicted 1029
6 SASI_Rn02_00229880 predicted 7247
7 SASI_Rn02_00229881 predicted 1147
8 SASI_Rn02_00229882 predicted 2292
9 SASI_Rn02_00229883 predicted 8547
10 SASI_Rn02_00229884 predicted 7663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267160 predicted 6568
2 SASI_Mm01_00267162 predicted 9502
3 SASI_Mm01_00267164 predicted 4868
4 SASI_Mm02_00425478 predicted 9841
5 SASI_Mm02_00425479 predicted 4806
6 SASI_Mm01_00267165 predicted 2346
7 SASI_Mm01_00267166 predicted 2603
8 SASI_Mm02_00425480 predicted 6559
9 SASI_Mm01_00267167 predicted 1593
10 SASI_Mm02_00425481 predicted 7586
11 SASI_Mm01_00267158 predicted 3664
12 SASI_Mm01_00267159 predicted 3083
13 SASI_Mm01_00267161 predicted 502
14 SASI_Mm01_00267163 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447871 predicted 6271
2 SASI_Mm02_00447872 predicted 9189
3 SASI_Mm02_00447873 predicted 4557
4 SASI_Mm02_00447874 predicted 9530
5 SASI_Mm02_00447875 predicted 4496
6 SASI_Mm02_00447876 predicted 2042
7 SASI_Mm02_00447877 predicted 2301
8 SASI_Mm02_00447878 predicted 6250
9 SASI_Mm02_00447879 predicted 1286
10 SASI_Mm02_00447880 predicted 7281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003737
VALIDATED
DCHS1 MISSION shRNA Bacterial Glycerol Stock
dachsous 1 (Drosophila)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000055948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-7057s1c1
Sequence:CCGGGCTCAGAGATTGCACAGGTAACTCGAGTTACCTGTGCAATCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-2541s1c1
Sequence:CCGGCCACCCATATTTGAGCAACTACTCGAGTAGTTGCTCAAATATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-8973s1c1
Sequence:CCGGCCTGACCTCAACCTGCTATTACTCGAGTAATAGCAGGTTGAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-8193s1c1
Sequence:CCGGGCTCGACATCAGCTTGTAGTACTCGAGTACTACAAGCTGATGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003737
VALIDATED
DCHS1 MISSION shRNA shRNA Plasmid DNA
dachsous 1 (Drosophila)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000055948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-7057s1c1
Sequence:CCGGGCTCAGAGATTGCACAGGTAACTCGAGTTACCTGTGCAATCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-2541s1c1
Sequence:CCGGCCACCCATATTTGAGCAACTACTCGAGTAGTTGCTCAAATATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-8973s1c1
Sequence:CCGGCCTGACCTCAACCTGCTATTACTCGAGTAATAGCAGGTTGAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-8193s1c1
Sequence:CCGGGCTCGACATCAGCTTGTAGTACTCGAGTACTACAAGCTGATGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003737
VALIDATED
DCHS1 MISSION shRNA Lentiviral Transduction Particles
dachsous 1 (Drosophila)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000055948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-7057s1c1
Sequence:CCGGGCTCAGAGATTGCACAGGTAACTCGAGTTACCTGTGCAATCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-2541s1c1
Sequence:CCGGCCACCCATATTTGAGCAACTACTCGAGTAGTTGCTCAAATATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-8973s1c1
Sequence:CCGGCCTGACCTCAACCTGCTATTACTCGAGTAATAGCAGGTTGAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003737.1-8193s1c1
Sequence:CCGGGCTCGACATCAGCTTGTAGTACTCGAGTACTACAAGCTGATGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162943
DCHS1 MISSION shRNA Bacterial Glycerol Stock
dachsous 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-3882s21c1
Sequence:CCGGTGTCGCTGTGCTCGATCTTAACTCGAGTTAAGATCGAGCACAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-3472s21c1
Sequence:CCGGCGTGAGTCCCAGGAGTTATACCTCGAGGTATAACTCCTGGGACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-9416s21c1
Sequence:CCGGTCCGCATGATCAACGAGTTTCCTCGAGGAAACTCGTTGATCATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162943.1-10264s21c1
Sequence:CCGGCTCGGACCATGACTGACTATGCTCGAGCATAGTCAGTCATGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-2807s21c1
Sequence:CCGGATTCACCCTCAGGGCTATTAACTCGAGTTAATAGCCCTGAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162943
DCHS1 MISSION shRNA shRNA Plasmid DNA
dachsous 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-3882s21c1
Sequence:CCGGTGTCGCTGTGCTCGATCTTAACTCGAGTTAAGATCGAGCACAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-3472s21c1
Sequence:CCGGCGTGAGTCCCAGGAGTTATACCTCGAGGTATAACTCCTGGGACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-9416s21c1
Sequence:CCGGTCCGCATGATCAACGAGTTTCCTCGAGGAAACTCGTTGATCATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162943.1-10264s21c1
Sequence:CCGGCTCGGACCATGACTGACTATGCTCGAGCATAGTCAGTCATGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-2807s21c1
Sequence:CCGGATTCACCCTCAGGGCTATTAACTCGAGTTAATAGCCCTGAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162943
DCHS1 MISSION shRNA Lentiviral Transduction Particles
dachsous 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-3882s21c1
Sequence:CCGGTGTCGCTGTGCTCGATCTTAACTCGAGTTAAGATCGAGCACAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-3472s21c1
Sequence:CCGGCGTGAGTCCCAGGAGTTATACCTCGAGGTATAACTCCTGGGACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-9416s21c1
Sequence:CCGGTCCGCATGATCAACGAGTTTCCTCGAGGAAACTCGTTGATCATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162943.1-10264s21c1
Sequence:CCGGCTCGGACCATGACTGACTATGCTCGAGCATAGTCAGTCATGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162943.1-2807s21c1
Sequence:CCGGATTCACCCTCAGGGCTATTAACTCGAGTTAATAGCCCTGAGGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks