EMAIL THIS PAGE TO A FRIEND

DCHS2

dachsous 2 (Drosophila)

74 Gene Product Result for
Synonyms: CDH27 CDHJ CDHR7 PCDH23 PCDHJ
UniProtKB ID: Q6V1P9, E9PC11, Q4W5P9, Q6ZS61, Q9NXU8
Gene ID:
Mouse(229459) dachsous 2 (Drosophila)
Rat(310550) dachsous 2 (Drosophila)
dog(612486) dachsous 2 (Drosophila)
cow(539323) dachsous 2 (Drosophila)
dog(482659) protocadherin-23-like
sheep(101122136) dachsous 2 (Drosophila)
naked mole-rat(101702888) dachsous 2 (Drosophila)
domestic guinea pig(100720091) dachsous 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA064159 Anti-DCHS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017639 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092771 MISSION® esiRNA esiRNA human DCHS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017639 Rosetta Predictions human pricing
NM_199348 Rosetta Predictions human pricing
XM_227313 Rosetta Predictions rat pricing
XR_008777 Rosetta Predictions rat pricing
XM_143371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108294 predicted 4129
2 SASI_Hs01_00108295 predicted 6174
3 SASI_Hs01_00108297 predicted 6454
4 SASI_Hs01_00108299 predicted 2358
5 SASI_Hs01_00108300 predicted 7802
6 SASI_Hs02_00350329 predicted 6110
7 SASI_Hs01_00108301 predicted 535
8 SASI_Hs02_00350330 predicted 3214
9 SASI_Hs01_00108302 predicted 2675
10 SASI_Hs02_00350331 predicted 5395
11 SASI_Hs01_00108293 predicted 5400
12 SASI_Hs01_00108296 predicted 2172
13 SASI_Hs01_00108298 predicted 8426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201397 predicted 3000
2 SASI_Hs01_00201398 predicted 2783
3 SASI_Hs01_00201399 predicted 4030
4 SASI_Hs01_00201400 predicted 2680
5 SASI_Hs01_00201401 predicted 2471
6 SASI_Hs01_00201402 predicted 2827
7 SASI_Hs01_00201403 predicted 1596
8 SASI_Hs01_00201404 predicted 2485
9 SASI_Hs01_00201405 predicted 3036
10 SASI_Hs01_00201406 predicted 3623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177292 predicted 1194
2 SASI_Rn01_00177293 predicted 482
3 SASI_Rn01_00177294 predicted 1216
4 SASI_Rn01_00177295 predicted 867
5 SASI_Rn01_00177296 predicted 497
6 SASI_Rn01_00177297 predicted 995
7 SASI_Rn01_00177298 predicted 990
8 SASI_Rn01_00177299 predicted 602
9 SASI_Rn01_00177300 predicted 905
10 SASI_Rn01_00177301 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417882 predicted 8222
2 SASI_Rn02_00417883 predicted 3034
3 SASI_Rn02_00417884 predicted 2681
4 SASI_Rn02_00417885 predicted 238
5 SASI_Rn02_00417886 predicted 6170
6 SASI_Rn02_00417887 predicted 2453
7 SASI_Rn02_00417888 predicted 8643
8 SASI_Rn02_00417889 predicted 5425
9 SASI_Rn02_00417890 predicted 5964
10 SASI_Rn02_00417891 predicted 4737
11 SASI_Rn01_00185888 predicted 2138
12 SASI_Rn01_00185889 predicted 1423
13 SASI_Rn01_00185890 predicted 2154
14 SASI_Rn01_00185891 predicted 1815
15 SASI_Rn01_00185892 predicted 1438
16 SASI_Rn01_00185893 predicted 1941
17 SASI_Rn01_00185894 predicted 1934
18 SASI_Rn01_00185895 predicted 1550
19 SASI_Rn01_00185896 predicted 1857
20 SASI_Rn01_00185897 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253457 predicted 7672
2 SASI_Mm02_00425181 predicted 5911
3 SASI_Mm01_00253458 predicted 4517
4 SASI_Mm02_00425182 predicted 1720
5 SASI_Mm01_00253460 predicted 6198
6 SASI_Mm01_00253462 predicted 4225
7 SASI_Mm01_00253463 predicted 3157
8 SASI_Mm01_00253464 predicted 7880
9 SASI_Mm01_00253466 predicted 1498
10 SASI_Mm02_00425183 predicted 2205
11 SASI_Mm01_00253459 predicted 4355
12 SASI_Mm01_00253461 predicted 1745
13 SASI_Mm01_00253465 predicted 7229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199348
DCHS2 MISSION shRNA Bacterial Glycerol Stock
dachsous 2 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-1866s1c1
Sequence:CCGGCGCGATCTGTATGAGTTACTACTCGAGTAGTAACTCATACAGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3307s1c1
Sequence:CCGGCCTCGGATGAGATTAGAATATCTCGAGATATTCTAATCTCATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-4353s1c1
Sequence:CCGGGCAGAAGTTACATACTCAGTACTCGAGTACTGAGTATGTAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3795s1c1
Sequence:CCGGCGGCGACAGTTTGACTATGAACTCGAGTTCATAGTCAAACTGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3251s1c1
Sequence:CCGGCGAGGTCAACATAACAGTCATCTCGAGATGACTGTTATGTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199348
DCHS2 MISSION shRNA shRNA Plasmid DNA
dachsous 2 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-1866s1c1
Sequence:CCGGCGCGATCTGTATGAGTTACTACTCGAGTAGTAACTCATACAGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3307s1c1
Sequence:CCGGCCTCGGATGAGATTAGAATATCTCGAGATATTCTAATCTCATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-4353s1c1
Sequence:CCGGGCAGAAGTTACATACTCAGTACTCGAGTACTGAGTATGTAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3795s1c1
Sequence:CCGGCGGCGACAGTTTGACTATGAACTCGAGTTCATAGTCAAACTGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3251s1c1
Sequence:CCGGCGAGGTCAACATAACAGTCATCTCGAGATGACTGTTATGTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199348
DCHS2 MISSION shRNA Lentiviral Transduction Particles
dachsous 2 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-1866s1c1
Sequence:CCGGCGCGATCTGTATGAGTTACTACTCGAGTAGTAACTCATACAGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3307s1c1
Sequence:CCGGCCTCGGATGAGATTAGAATATCTCGAGATATTCTAATCTCATCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-4353s1c1
Sequence:CCGGGCAGAAGTTACATACTCAGTACTCGAGTACTGAGTATGTAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3795s1c1
Sequence:CCGGCGGCGACAGTTTGACTATGAACTCGAGTTCATAGTCAAACTGTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199348.1-3251s1c1
Sequence:CCGGCGAGGTCAACATAACAGTCATCTCGAGATGACTGTTATGTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017639
DCHS2 MISSION shRNA Bacterial Glycerol Stock
dachsous 2 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-446s1c1
Sequence:CCGGCCGTATTACTTCTGGATACAACTCGAGTTGTATCCAGAAGTAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-2137s1c1
Sequence:CCGGCCGGAATGGTTGAGTTTAATACTCGAGTATTAAACTCAACCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-2653s1c1
Sequence:CCGGGAGCCCAAATTCCAACCTCTTCTCGAGAAGAGGTTGGAATTTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-343s1c1
Sequence:CCGGGCCACAGACTTAGAAAGCAATCTCGAGATTGCTTTCTAAGTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-1298s1c1
Sequence:CCGGGCTCTATAAATGCTCTGGATTCTCGAGAATCCAGAGCATTTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017639
DCHS2 MISSION shRNA shRNA Plasmid DNA
dachsous 2 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-446s1c1
Sequence:CCGGCCGTATTACTTCTGGATACAACTCGAGTTGTATCCAGAAGTAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-2137s1c1
Sequence:CCGGCCGGAATGGTTGAGTTTAATACTCGAGTATTAAACTCAACCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-2653s1c1
Sequence:CCGGGAGCCCAAATTCCAACCTCTTCTCGAGAAGAGGTTGGAATTTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-343s1c1
Sequence:CCGGGCCACAGACTTAGAAAGCAATCTCGAGATTGCTTTCTAAGTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-1298s1c1
Sequence:CCGGGCTCTATAAATGCTCTGGATTCTCGAGAATCCAGAGCATTTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017639
DCHS2 MISSION shRNA Lentiviral Transduction Particles
dachsous 2 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-446s1c1
Sequence:CCGGCCGTATTACTTCTGGATACAACTCGAGTTGTATCCAGAAGTAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-2137s1c1
Sequence:CCGGCCGGAATGGTTGAGTTTAATACTCGAGTATTAAACTCAACCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-2653s1c1
Sequence:CCGGGAGCCCAAATTCCAACCTCTTCTCGAGAAGAGGTTGGAATTTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-343s1c1
Sequence:CCGGGCCACAGACTTAGAAAGCAATCTCGAGATTGCTTTCTAAGTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017639.1-1298s1c1
Sequence:CCGGGCTCTATAAATGCTCTGGATTCTCGAGAATCCAGAGCATTTATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks