EMAIL THIS PAGE TO A FRIEND

DCK

deoxycytidine kinase

79 Gene Product Result for
UniProtKB ID: P27707, B2R8V6, Q5TZY7, Q6FI11
Gene ID:
Human(1633) Summary: Deoxycytidine kinase (DCK) is required for the phosphorylation of several deoxyribonucleosides and their nucleoside analogs. Deficiency of DCK is associated with resistance to antiviral and anticancer chemotherapeutic agents. Conversely, increased deoxycytidine kinase activity is associated with increased activation of these compounds to cytotoxic nucleoside triphosphate derivatives. DCK is clinically important because of its relationship to drug resistance and sensitivity. [provided by RefSeq, Jul 2008]
Mouse(13178) deoxycytidine kinase
Rat(79127) deoxycytidine kinase
Zebrafish(474325) deoxycytidine kinase
chicken(422648) deoxycytidine kinase
cow(530642) deoxycytidine kinase
domestic cat(101083845) deoxycytidine kinase
dog(482188) deoxycytidine kinase
domestic guinea pig(100713916) deoxycytidine kinase
naked mole-rat(101722212) deoxycytidine kinase
sheep(101123378) deoxycytidine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D1285 2′,3′-Dideoxyadenosine ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000788 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000741 MISSION® esiRNA esiRNA targeting human DCK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000788 Rosetta Predictions human pricing
NM_024158 Rosetta Predictions rat pricing
NM_007832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136486 predicted 767
2 SASI_Hs01_00136488 predicted 817
3 SASI_Hs01_00136490 predicted 701
4 SASI_Hs01_00136491 predicted 253
5 SASI_Hs01_00136492 predicted 393
6 SASI_Hs01_00136493 predicted 826
7 SASI_Hs02_00303230 predicted 337
8 SASI_Hs02_00303231 predicted 852
9 SASI_Hs02_00303232 predicted 590
10 SASI_Hs02_00303233 predicted 779
11 SASI_Hs01_00136487 predicted 330
12 SASI_Hs01_00136489 predicted 263
13 SASI_Hs01_00136494 predicted 295
14 SASI_Hs01_00136495 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069833 predicted 465
2 SASI_Rn01_00069834 predicted 708
3 SASI_Rn01_00069835 predicted 461
4 SASI_Rn01_00069836 predicted 209
5 SASI_Rn01_00069837 predicted 223
6 SASI_Rn01_00069838 predicted 475
7 SASI_Rn01_00069839 predicted 244
8 SASI_Rn01_00069840 predicted 562
9 SASI_Rn01_00069841 predicted 207
10 SASI_Rn01_00069842 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173563 predicted 519
2 SASI_Mm01_00173564 predicted 1002
3 SASI_Mm01_00173565 predicted 790
4 SASI_Mm01_00173566 predicted 970
5 SASI_Mm01_00173567 predicted 1102
6 SASI_Mm01_00173568 predicted 484
7 SASI_Mm02_00312569 predicted 661
8 SASI_Mm01_00173569 predicted 990
9 SASI_Mm01_00173570 predicted 434
10 SASI_Mm01_00173571 predicted 442
11 SASI_Mm01_00173572 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000788
VALIDATED
DCK MISSION shRNA Bacterial Glycerol Stock
deoxycytidine kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000788.x-440s1c1
Sequence:CCGGTTACCTTCCAAACATATGCCTCTCGAGAGGCATATGTTTGGAAGGTAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.x-605s1c1
Sequence:CCGGAGACAGAGTGGACAATTTATCCTCGAGGATAAATTGTCCACTCTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000788.x-537s1c1
Sequence:CCGGTGAACGATCTGTGTATAGTGACTCGAGTCACTATACACAGATCGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-1534s1c1
Sequence:CCGGGCAGCCTGCTATAAAGTTAAACTCGAGTTTAACTTTATAGCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000788.1-706s1c1
Sequence:CCGGGAGACATGCTTACATAGAATACTCGAGTATTCTATGTAAGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-987s1c1
Sequence:CCGGGCTTTGTGTATCTTCGTAACTCTCGAGAGTTACGAAGATACACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-805s1c1
Sequence:CCGGCTCCTGCATAGGACACTGAAACTCGAGTTTCAGTGTCCTATGCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-666s1c1
Sequence:CCGGCCTTGAATTGGATGGAATCATCTCGAGATGATTCCATCCAATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-827s1c1
Sequence:CCGGCCAACTTCGATTATCTTCAAGCTCGAGCTTGAAGATAATCGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000788
VALIDATED
DCK MISSION shRNA shRNA Plasmid DNA
deoxycytidine kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000788.x-440s1c1
Sequence:CCGGTTACCTTCCAAACATATGCCTCTCGAGAGGCATATGTTTGGAAGGTAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.x-605s1c1
Sequence:CCGGAGACAGAGTGGACAATTTATCCTCGAGGATAAATTGTCCACTCTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000788.x-537s1c1
Sequence:CCGGTGAACGATCTGTGTATAGTGACTCGAGTCACTATACACAGATCGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-1534s1c1
Sequence:CCGGGCAGCCTGCTATAAAGTTAAACTCGAGTTTAACTTTATAGCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000788.1-706s1c1
Sequence:CCGGGAGACATGCTTACATAGAATACTCGAGTATTCTATGTAAGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-987s1c1
Sequence:CCGGGCTTTGTGTATCTTCGTAACTCTCGAGAGTTACGAAGATACACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-805s1c1
Sequence:CCGGCTCCTGCATAGGACACTGAAACTCGAGTTTCAGTGTCCTATGCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-666s1c1
Sequence:CCGGCCTTGAATTGGATGGAATCATCTCGAGATGATTCCATCCAATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-827s1c1
Sequence:CCGGCCAACTTCGATTATCTTCAAGCTCGAGCTTGAAGATAATCGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000788
VALIDATED
DCK MISSION shRNA Lentiviral Transduction Particles
deoxycytidine kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000788.x-440s1c1
Sequence:CCGGTTACCTTCCAAACATATGCCTCTCGAGAGGCATATGTTTGGAAGGTAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.x-605s1c1
Sequence:CCGGAGACAGAGTGGACAATTTATCCTCGAGGATAAATTGTCCACTCTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000788.x-537s1c1
Sequence:CCGGTGAACGATCTGTGTATAGTGACTCGAGTCACTATACACAGATCGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-1534s1c1
Sequence:CCGGGCAGCCTGCTATAAAGTTAAACTCGAGTTTAACTTTATAGCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000788.1-706s1c1
Sequence:CCGGGAGACATGCTTACATAGAATACTCGAGTATTCTATGTAAGCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-987s1c1
Sequence:CCGGGCTTTGTGTATCTTCGTAACTCTCGAGAGTTACGAAGATACACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-805s1c1
Sequence:CCGGCTCCTGCATAGGACACTGAAACTCGAGTTTCAGTGTCCTATGCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-666s1c1
Sequence:CCGGCCTTGAATTGGATGGAATCATCTCGAGATGATTCCATCCAATTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000788.1-827s1c1
Sequence:CCGGCCAACTTCGATTATCTTCAAGCTCGAGCTTGAAGATAATCGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007832
VALIDATED
DCK MISSION shRNA Bacterial Glycerol Stock
deoxycytidine kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-735s1c1
Sequence:CCGGGCCTTGAATTGGATGGAATAACTCGAGTTATTCCATCCAATTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-459s1c1
Sequence:CCGGGCGGTGGAAATGTTCTTCAAACTCGAGTTTGAAGAACATTTCCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007832.3-935s1c1
Sequence:CCGGCTGGATGTTAATGAAGACTTTCTCGAGAAAGTCTTCATTAACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-420s1c1
Sequence:CCGGCTCAAGAGGAATTTGAGGAATCTCGAGATTCCTCAAATTCCTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007832.3-584s1c1
Sequence:CCGGGCAGAGAAACCTGTATTATTTCTCGAGAAATAATACAGGTTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-598s21c1
Sequence:CCGGGCAGAGAAACCTGTATTATTTCTCGAGAAATAATACAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-473s21c1
Sequence:CCGGGCGGTGGAAATGTTCTTCAAACTCGAGTTTGAAGAACATTTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-949s21c1
Sequence:CCGGCTGGATGTTAATGAAGACTTTCTCGAGAAAGTCTTCATTAACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-749s21c1
Sequence:CCGGGCCTTGAATTGGATGGAATAACTCGAGTTATTCCATCCAATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007832
VALIDATED
DCK MISSION shRNA shRNA Plasmid DNA
deoxycytidine kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-735s1c1
Sequence:CCGGGCCTTGAATTGGATGGAATAACTCGAGTTATTCCATCCAATTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-459s1c1
Sequence:CCGGGCGGTGGAAATGTTCTTCAAACTCGAGTTTGAAGAACATTTCCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007832.3-935s1c1
Sequence:CCGGCTGGATGTTAATGAAGACTTTCTCGAGAAAGTCTTCATTAACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-420s1c1
Sequence:CCGGCTCAAGAGGAATTTGAGGAATCTCGAGATTCCTCAAATTCCTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007832.3-584s1c1
Sequence:CCGGGCAGAGAAACCTGTATTATTTCTCGAGAAATAATACAGGTTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-598s21c1
Sequence:CCGGGCAGAGAAACCTGTATTATTTCTCGAGAAATAATACAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-473s21c1
Sequence:CCGGGCGGTGGAAATGTTCTTCAAACTCGAGTTTGAAGAACATTTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-949s21c1
Sequence:CCGGCTGGATGTTAATGAAGACTTTCTCGAGAAAGTCTTCATTAACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-749s21c1
Sequence:CCGGGCCTTGAATTGGATGGAATAACTCGAGTTATTCCATCCAATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007832
VALIDATED
DCK MISSION shRNA Lentiviral Transduction Particles
deoxycytidine kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-735s1c1
Sequence:CCGGGCCTTGAATTGGATGGAATAACTCGAGTTATTCCATCCAATTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-459s1c1
Sequence:CCGGGCGGTGGAAATGTTCTTCAAACTCGAGTTTGAAGAACATTTCCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007832.3-935s1c1
Sequence:CCGGCTGGATGTTAATGAAGACTTTCTCGAGAAAGTCTTCATTAACATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007832.3-420s1c1
Sequence:CCGGCTCAAGAGGAATTTGAGGAATCTCGAGATTCCTCAAATTCCTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007832.3-584s1c1
Sequence:CCGGGCAGAGAAACCTGTATTATTTCTCGAGAAATAATACAGGTTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-598s21c1
Sequence:CCGGGCAGAGAAACCTGTATTATTTCTCGAGAAATAATACAGGTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-473s21c1
Sequence:CCGGGCGGTGGAAATGTTCTTCAAACTCGAGTTTGAAGAACATTTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-949s21c1
Sequence:CCGGCTGGATGTTAATGAAGACTTTCTCGAGAAAGTCTTCATTAACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007832.4-749s21c1
Sequence:CCGGGCCTTGAATTGGATGGAATAACTCGAGTTATTCCATCCAATTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks