EMAIL THIS PAGE TO A FRIEND

DCLK1

doublecortin-like kinase 1

216 Gene Product Result for
Synonyms: CL1 CLICK1 DCAMKL1 DCDC3A DCLK
UniProtKB ID: O15075, B7Z3E9, Q5VZY8, Q5VZZ0, Q5VZZ1
Gene ID:
Human(9201) Summary: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been reported, but the full-length nature and biological validity of some variants have not been defined. These variants encode different isoforms, which are differentially expressed and have different kinase activities.[provided by RefSeq, Sep 2010]
Mouse(13175) doublecortin-like kinase 1
Rat(83825) doublecortin-like kinase 1
chicken(418903) doublecortin-like kinase 1
domestic cat(101083643) doublecortin-like kinase 1
Horse(100062396) doublecortin-like kinase 1
cow(613449) doublecortin-like kinase 1
dog(477304) doublecortin-like kinase 1
sheep(101106340) doublecortin-like kinase 1
naked mole-rat(101719985) doublecortin-like kinase 1
domestic guinea pig(100725335) doublecortin-like kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300015 Anti-DCAMKL1 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1305446 ANTI-DCAMKL1(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305341 ANTI-DCAMKL1(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB4200294 Anti-DCLK1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, mouse
immunoprecipitation, western blot pricing
SAB4200186 Anti-DCLK1 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody rat, human, mouse
western blot pricing
HPA015655 Anti-DCLK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA015040 Anti-DCLK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0009201M2 Monoclonal Anti-DCAMKL1 antibody produced in mouse clone 6F9, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB1409983 Monoclonal Anti-DCAMKL1 antibody produced in mouse clone 7D10, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1404683 Monoclonal Anti-DCAMKL1, (C-terminal) antibody produced in mouse clone 6H4, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004734 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004734 Rosetta Predictions human pricing
NM_053343 Rosetta Predictions rat pricing
NM_001111051 Rosetta Predictions mouse pricing
NM_001111052 Rosetta Predictions mouse pricing
NM_001111053 Rosetta Predictions mouse pricing
NM_019978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239632 predicted 407
2 SASI_Hs01_00239633 predicted 2065
3 SASI_Hs01_00239634 predicted 1540
4 SASI_Hs01_00239635 predicted 1591
5 SASI_Hs01_00239636 predicted 1349
6 SASI_Hs01_00239637 predicted 373
7 SASI_Hs01_00239638 predicted 2276
8 SASI_Hs01_00239639 predicted 1487
9 SASI_Hs01_00239640 predicted 1534
10 SASI_Hs01_00239641 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265799 predicted 1197
2 SASI_Rn01_00084168 predicted 595
3 SASI_Rn01_00084169 predicted 350
4 SASI_Rn01_00084170 predicted 490
5 SASI_Rn01_00084173 predicted 352
6 SASI_Rn01_00084175 predicted 374
7 SASI_Rn01_00084176 predicted 894
8 SASI_Rn01_00084177 predicted 407
9 SASI_Rn02_00265800 predicted 592
10 SASI_Rn02_00265801 predicted 865
11 SASI_Rn01_00084171 predicted 556
12 SASI_Rn01_00084172 predicted 552
13 SASI_Rn01_00084174 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306215 predicted 806
2 SASI_Mm02_00306216 predicted 2071
3 SASI_Mm02_00306217 predicted 766
4 SASI_Mm02_00306218 predicted 744
5 SASI_Mm02_00306219 predicted 1203
6 SASI_Mm02_00306220 predicted 2086
7 SASI_Mm02_00306221 predicted 801
8 SASI_Mm02_00306222 predicted 2094
9 SASI_Mm02_00306223 predicted 1070
10 SASI_Mm02_00306224 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306225 predicted 811
2 SASI_Mm02_00306226 predicted 1045
3 SASI_Mm02_00306227 predicted 949
4 SASI_Mm02_00306228 predicted 771
5 SASI_Mm02_00306229 predicted 1196
6 SASI_Mm02_00306230 predicted 1071
7 SASI_Mm02_00306231 predicted 962
8 SASI_Mm02_00306232 predicted 1032
9 SASI_Mm02_00306233 predicted 719
10 SASI_Mm02_00306234 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306235 predicted 720
2 SASI_Mm02_00306236 predicted 933
3 SASI_Mm02_00306237 predicted 430
4 SASI_Mm02_00306238 predicted 767
5 SASI_Mm02_00306239 predicted 555
6 SASI_Mm02_00306240 predicted 407
7 SASI_Mm02_00306241 predicted 251
8 SASI_Mm02_00306242 predicted 847
9 SASI_Mm02_00306243 predicted 883
10 SASI_Mm02_00306244 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325285 predicted 1712
2 SASI_Mm02_00325286 predicted 2974
3 SASI_Mm01_00110921 predicted 1677
4 SASI_Mm02_00325287 predicted 1655
5 SASI_Mm01_00110922 predicted 2109
6 SASI_Mm02_00325288 predicted 2995
7 SASI_Mm02_00325289 predicted 1716
8 SASI_Mm02_00325290 predicted 3003
9 SASI_Mm01_00110923 predicted 1978
10 SASI_Mm02_00325291 predicted 1874
11 SASI_Mm01_00110917 predicted 329
12 SASI_Mm01_00110918 predicted 2047
13 SASI_Mm01_00110919 predicted 1337
14 SASI_Mm01_00110920 predicted 801
15 SASI_Mm01_00110924 predicted 352
16 SASI_Mm01_00110925 predicted 405
17 SASI_Mm01_00110926 predicted 1474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004734
DCLK1 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.3-2287s21c1
Sequence:CCGGTAGCACTGGACCACGGGTTTACTCGAGTAAACCCGTGGTCCAGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.3-507s21c1
Sequence:CCGGACCCGAACTCTGTCGGATAACCTCGAGGTTATCCGACAGAGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004734.2-3650s21c1
Sequence:CCGGCACCTTTAGGTTACCTATATACTCGAGTATATAGGTAACCTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-2100s21c1
Sequence:CCGGGTCGATGTAGATCAGCGATTTCTCGAGAAATCGCTGATCTACATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1727s21c1
Sequence:CCGGGAACATCGTCCACCGTGATATCTCGAGATATCACGGTGGACGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1639s21c1
Sequence:CCGGCCATTACTTCCACTAACAAATCTCGAGATTTGTTAGTGGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1363s21c1
Sequence:CCGGCTACAATAACAGAACGATATACTCGAGTATATCGTTCTGTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004734.3-2616s21c1
Sequence:CCGGTGATCTATCTAGCGCTCAATGCTCGAGCATTGAGCGCTAGATAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-525s1c1
Sequence:CCGGGTGAGAACAATCTACACCATTCTCGAGAATGGTGTAGATTGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-399s1c1
Sequence:CCGGCGAAACGGAGATCGATACTTCCTCGAGGAAGTATCGATCTCCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-1639s1c1
Sequence:CCGGCCATTACTTCCACTAACAAATCTCGAGATTTGTTAGTGGAAGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1361s1c1
Sequence:CCGGAGCTACAATAACAGAACGATACTCGAGTATCGTTCTGTTATTGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1590s1c1
Sequence:CCGGGAACTGTATCTTGTCATGGAACTCGAGTTCCATGACAAGATACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1702s1c1
Sequence:CCGGGCGCCATCAAATACCTGCATACTCGAGTATGCAGGTATTTGATGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004734
DCLK1 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.3-2287s21c1
Sequence:CCGGTAGCACTGGACCACGGGTTTACTCGAGTAAACCCGTGGTCCAGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.3-507s21c1
Sequence:CCGGACCCGAACTCTGTCGGATAACCTCGAGGTTATCCGACAGAGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004734.2-3650s21c1
Sequence:CCGGCACCTTTAGGTTACCTATATACTCGAGTATATAGGTAACCTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-2100s21c1
Sequence:CCGGGTCGATGTAGATCAGCGATTTCTCGAGAAATCGCTGATCTACATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1727s21c1
Sequence:CCGGGAACATCGTCCACCGTGATATCTCGAGATATCACGGTGGACGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1639s21c1
Sequence:CCGGCCATTACTTCCACTAACAAATCTCGAGATTTGTTAGTGGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1363s21c1
Sequence:CCGGCTACAATAACAGAACGATATACTCGAGTATATCGTTCTGTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004734.3-2616s21c1
Sequence:CCGGTGATCTATCTAGCGCTCAATGCTCGAGCATTGAGCGCTAGATAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-525s1c1
Sequence:CCGGGTGAGAACAATCTACACCATTCTCGAGAATGGTGTAGATTGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-399s1c1
Sequence:CCGGCGAAACGGAGATCGATACTTCCTCGAGGAAGTATCGATCTCCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-1639s1c1
Sequence:CCGGCCATTACTTCCACTAACAAATCTCGAGATTTGTTAGTGGAAGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1361s1c1
Sequence:CCGGAGCTACAATAACAGAACGATACTCGAGTATCGTTCTGTTATTGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1590s1c1
Sequence:CCGGGAACTGTATCTTGTCATGGAACTCGAGTTCCATGACAAGATACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1702s1c1
Sequence:CCGGGCGCCATCAAATACCTGCATACTCGAGTATGCAGGTATTTGATGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004734
DCLK1 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.3-2287s21c1
Sequence:CCGGTAGCACTGGACCACGGGTTTACTCGAGTAAACCCGTGGTCCAGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.3-507s21c1
Sequence:CCGGACCCGAACTCTGTCGGATAACCTCGAGGTTATCCGACAGAGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004734.2-3650s21c1
Sequence:CCGGCACCTTTAGGTTACCTATATACTCGAGTATATAGGTAACCTAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-2100s21c1
Sequence:CCGGGTCGATGTAGATCAGCGATTTCTCGAGAAATCGCTGATCTACATCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1727s21c1
Sequence:CCGGGAACATCGTCCACCGTGATATCTCGAGATATCACGGTGGACGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1639s21c1
Sequence:CCGGCCATTACTTCCACTAACAAATCTCGAGATTTGTTAGTGGAAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004734.2-1363s21c1
Sequence:CCGGCTACAATAACAGAACGATATACTCGAGTATATCGTTCTGTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004734.3-2616s21c1
Sequence:CCGGTGATCTATCTAGCGCTCAATGCTCGAGCATTGAGCGCTAGATAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-525s1c1
Sequence:CCGGGTGAGAACAATCTACACCATTCTCGAGAATGGTGTAGATTGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-399s1c1
Sequence:CCGGCGAAACGGAGATCGATACTTCCTCGAGGAAGTATCGATCTCCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004734.2-1639s1c1
Sequence:CCGGCCATTACTTCCACTAACAAATCTCGAGATTTGTTAGTGGAAGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1361s1c1
Sequence:CCGGAGCTACAATAACAGAACGATACTCGAGTATCGTTCTGTTATTGTAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1590s1c1
Sequence:CCGGGAACTGTATCTTGTCATGGAACTCGAGTTCCATGACAAGATACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004734.x-1702s1c1
Sequence:CCGGGCGCCATCAAATACCTGCATACTCGAGTATGCAGGTATTTGATGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019978
DCLK1 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-1498s21c1
Sequence:CCGGGCTGTTGTCAAGGAATGTATACTCGAGTATACATTCCTTGACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019978.3-2529s21c1
Sequence:CCGGTACTCGAAGTCCTAGCTTAACCTCGAGGTTAAGCTAGGACTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-2119s21c1
Sequence:CCGGCCATCTCCGTATTGGGACAATCTCGAGATTGTCCCAATACGGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-442s21c1
Sequence:CCGGGACCGCTACTTCAAAGGAATTCTCGAGAATTCCTTTGAAGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-1528s1c1
Sequence:CCGGCCCAACATTGTCCTCCTGATTCTCGAGAATCAGGAGGACAATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-1396s1c1
Sequence:CCGGGCTGTTGTCAAGGAATGTATACTCGAGTATACATTCCTTGACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-549s1c1
Sequence:CCGGGCCCTTTAAGAAGCTGGAGTACTCGAGTACTCCAGCTTCTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-2017s1c1
Sequence:CCGGCCATCTCCGTATTGGGACAATCTCGAGATTGTCCCAATACGGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-340s1c1
Sequence:CCGGGACCGCTACTTCAAAGGAATTCTCGAGAATTCCTTTGAAGTAGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019978
DCLK1 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-1498s21c1
Sequence:CCGGGCTGTTGTCAAGGAATGTATACTCGAGTATACATTCCTTGACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019978.3-2529s21c1
Sequence:CCGGTACTCGAAGTCCTAGCTTAACCTCGAGGTTAAGCTAGGACTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-2119s21c1
Sequence:CCGGCCATCTCCGTATTGGGACAATCTCGAGATTGTCCCAATACGGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-442s21c1
Sequence:CCGGGACCGCTACTTCAAAGGAATTCTCGAGAATTCCTTTGAAGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-1528s1c1
Sequence:CCGGCCCAACATTGTCCTCCTGATTCTCGAGAATCAGGAGGACAATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-1396s1c1
Sequence:CCGGGCTGTTGTCAAGGAATGTATACTCGAGTATACATTCCTTGACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-549s1c1
Sequence:CCGGGCCCTTTAAGAAGCTGGAGTACTCGAGTACTCCAGCTTCTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-2017s1c1
Sequence:CCGGCCATCTCCGTATTGGGACAATCTCGAGATTGTCCCAATACGGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-340s1c1
Sequence:CCGGGACCGCTACTTCAAAGGAATTCTCGAGAATTCCTTTGAAGTAGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019978
DCLK1 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-1498s21c1
Sequence:CCGGGCTGTTGTCAAGGAATGTATACTCGAGTATACATTCCTTGACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019978.3-2529s21c1
Sequence:CCGGTACTCGAAGTCCTAGCTTAACCTCGAGGTTAAGCTAGGACTTCGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-2119s21c1
Sequence:CCGGCCATCTCCGTATTGGGACAATCTCGAGATTGTCCCAATACGGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019978.3-442s21c1
Sequence:CCGGGACCGCTACTTCAAAGGAATTCTCGAGAATTCCTTTGAAGTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-1528s1c1
Sequence:CCGGCCCAACATTGTCCTCCTGATTCTCGAGAATCAGGAGGACAATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-1396s1c1
Sequence:CCGGGCTGTTGTCAAGGAATGTATACTCGAGTATACATTCCTTGACAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-549s1c1
Sequence:CCGGGCCCTTTAAGAAGCTGGAGTACTCGAGTACTCCAGCTTCTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-2017s1c1
Sequence:CCGGCCATCTCCGTATTGGGACAATCTCGAGATTGTCCCAATACGGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019978.1-340s1c1
Sequence:CCGGGACCGCTACTTCAAAGGAATTCTCGAGAATTCCTTTGAAGTAGCGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks