EMAIL THIS PAGE TO A FRIEND

DCLK2

doublecortin-like kinase 2

130 Gene Product Result for
Synonyms: CL2 CLICK-II CLICK2 CLIK2 DCAMKL2 DCDC3 DCDC3B DCK2
UniProtKB ID: Q8N568, C9J5Q9, Q59GC8, Q8N399
Gene ID:
Human(166614) Summary: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. Mouse studies show that the DCX gene, another family member, and this gene share function in the establishment of hippocampal organization and that their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Sep 2010]
Mouse(70762) doublecortin-like kinase 2
Rat(310698) doublecortin-like kinase 2
Zebrafish(572548) doublecortin-like kinase 2
domestic cat(101093682) doublecortin-like kinase 2
Horse(100062533) doublecortin-like kinase 2
dog(482642) doublecortin-like kinase 2
chicken(422473) doublecortin-like kinase 2
cow(536110) doublecortin-like kinase 2
domestic guinea pig(100715349) doublecortin-like kinase 2
naked mole-rat(101709014) doublecortin-like kinase 2
sheep(101103094) doublecortin-like kinase 2
Domestic Rabbit(100356475) doublecortin-like kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001040260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040260 Rosetta Predictions human pricing
NM_001040261 Rosetta Predictions human pricing
NM_001009691 Rosetta Predictions rat pricing
XM_579311 Rosetta Predictions rat pricing
NM_027539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081265 predicted 1522
2 SASI_Hs01_00081266 predicted 551
3 SASI_Hs01_00081267 predicted 1438
4 SASI_Hs01_00081268 predicted 1394
5 SASI_Hs02_00308910 predicted 1523
6 SASI_Hs01_00081269 predicted 686
7 SASI_Hs01_00081270 predicted 1969
8 SASI_Hs01_00081271 predicted 1536
9 SASI_Hs01_00081272 predicted 302
10 SASI_Hs01_00081273 predicted 778
11 SASI_Hs01_00081264 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087091 predicted 1511
2 SASI_Hs01_00087092 predicted 544
3 SASI_Hs01_00087093 predicted 1433
4 SASI_Hs01_00087094 predicted 1388
5 SASI_Hs02_00308911 predicted 1516
6 SASI_Hs01_00087095 predicted 683
7 SASI_Hs01_00087096 predicted 1961
8 SASI_Hs01_00087097 predicted 1535
9 SASI_Hs01_00087098 predicted 311
10 SASI_Hs01_00087099 predicted 782
11 SASI_Hs01_00087090 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105068 predicted 1380
2 SASI_Rn01_00105069 predicted 1786
3 SASI_Rn01_00105070 predicted 1677
4 SASI_Rn01_00105071 predicted 2005
5 SASI_Rn01_00105072 predicted 755
6 SASI_Rn01_00105073 predicted 2084
7 SASI_Rn01_00105074 predicted 1413
8 SASI_Rn01_00105075 predicted 287
9 SASI_Rn01_00105076 predicted 1369
10 SASI_Rn01_00105077 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186235 predicted 769
2 SASI_Rn01_00186236 predicted 1790
3 SASI_Rn01_00186237 predicted 1685
4 SASI_Rn01_00186238 predicted 1890
5 SASI_Rn01_00186239 predicted 1724
6 SASI_Rn01_00186240 predicted 1850
7 SASI_Rn01_00186241 predicted 1949
8 SASI_Rn01_00186242 predicted 1807
9 SASI_Rn01_00186243 predicted 1655
10 SASI_Rn01_00186244 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028342 predicted 1965
2 SASI_Mm01_00028343 predicted 2141
3 SASI_Mm01_00028344 predicted 1156
4 SASI_Mm01_00028345 predicted 2295
5 SASI_Mm01_00028346 predicted 2585
6 SASI_Mm01_00028347 predicted 1541
7 SASI_Mm01_00028348 predicted 1787
8 SASI_Mm01_00028349 predicted 2255
9 SASI_Mm01_00028350 predicted 2001
10 SASI_Mm01_00028351 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152619
VALIDATED
DCLK2 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-2730s1c1
Sequence:CCGGCCAGGAGAATGTGCAACTTTACTCGAGTAAAGTTGCACATTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-1378s1c1
Sequence:CCGGGCCGAGTGAAACATCCCAATACTCGAGTATTGGGATGTTTCACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152619.x-1927s1c1
Sequence:CCGGTCAGTCAAATGCTTCAGGTAACTCGAGTTACCTGAAGCATTTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152619.x-991s1c1
Sequence:CCGGGCAAATCACCAGCTTCAGTTACTCGAGTAACTGAAGCTGGTGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-1024s1c1
Sequence:CCGGGCAGCCAACTTTCTACTCCTACTCGAGTAGGAGTAGAAAGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152619
VALIDATED
DCLK2 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-2730s1c1
Sequence:CCGGCCAGGAGAATGTGCAACTTTACTCGAGTAAAGTTGCACATTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-1378s1c1
Sequence:CCGGGCCGAGTGAAACATCCCAATACTCGAGTATTGGGATGTTTCACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152619.x-1927s1c1
Sequence:CCGGTCAGTCAAATGCTTCAGGTAACTCGAGTTACCTGAAGCATTTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152619.x-991s1c1
Sequence:CCGGGCAAATCACCAGCTTCAGTTACTCGAGTAACTGAAGCTGGTGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-1024s1c1
Sequence:CCGGGCAGCCAACTTTCTACTCCTACTCGAGTAGGAGTAGAAAGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152619
VALIDATED
DCLK2 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001974    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-2730s1c1
Sequence:CCGGCCAGGAGAATGTGCAACTTTACTCGAGTAAAGTTGCACATTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-1378s1c1
Sequence:CCGGGCCGAGTGAAACATCCCAATACTCGAGTATTGGGATGTTTCACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152619.x-1927s1c1
Sequence:CCGGTCAGTCAAATGCTTCAGGTAACTCGAGTTACCTGAAGCATTTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152619.x-991s1c1
Sequence:CCGGGCAAATCACCAGCTTCAGTTACTCGAGTAACTGAAGCTGGTGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_152619.x-1024s1c1
Sequence:CCGGGCAGCCAACTTTCTACTCCTACTCGAGTAGGAGTAGAAAGTTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027539
DCLK2 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-1265s1c1
Sequence:CCGGCCCAAGTTAGTGACTGTGATTCTCGAGAATCACAGTCACTAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-1122s1c1
Sequence:CCGGCCTCCAACGAACCATTTCGTACTCGAGTACGAAATGGTTCGTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2667s1c1
Sequence:CCGGCCGAGGTTACAGGTAAACTAACTCGAGTTAGTTTACCTGTAACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2408s1c1
Sequence:CCGGGCTGGTGTGATTACATACATACTCGAGTATGTATGTAATCACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2549s1c1
Sequence:CCGGGCCAAGGAGTTAATCAGTCAACTCGAGTTGACTGATTAACTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-1598s21c1
Sequence:CCGGGAGCCTCAGCTGCGAAGTATTCTCGAGAATACTTCGCAGCTGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027539.4-3343s21c1
Sequence:CCGGGAAATGCATTGGACGAATTAGCTCGAGCTAATTCGTCCAATGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-2571s21c1
Sequence:CCGGAGACTCTGCCAAGGAGTTAATCTCGAGATTAACTCCTTGGCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-1914s21c1
Sequence:CCGGCGGCAACTTCGCGGTAGTTAACTCGAGTTAACTACCGCGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027539
DCLK2 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-1265s1c1
Sequence:CCGGCCCAAGTTAGTGACTGTGATTCTCGAGAATCACAGTCACTAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-1122s1c1
Sequence:CCGGCCTCCAACGAACCATTTCGTACTCGAGTACGAAATGGTTCGTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2667s1c1
Sequence:CCGGCCGAGGTTACAGGTAAACTAACTCGAGTTAGTTTACCTGTAACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2408s1c1
Sequence:CCGGGCTGGTGTGATTACATACATACTCGAGTATGTATGTAATCACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2549s1c1
Sequence:CCGGGCCAAGGAGTTAATCAGTCAACTCGAGTTGACTGATTAACTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-1598s21c1
Sequence:CCGGGAGCCTCAGCTGCGAAGTATTCTCGAGAATACTTCGCAGCTGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027539.4-3343s21c1
Sequence:CCGGGAAATGCATTGGACGAATTAGCTCGAGCTAATTCGTCCAATGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-2571s21c1
Sequence:CCGGAGACTCTGCCAAGGAGTTAATCTCGAGATTAACTCCTTGGCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-1914s21c1
Sequence:CCGGCGGCAACTTCGCGGTAGTTAACTCGAGTTAACTACCGCGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027539
DCLK2 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-1265s1c1
Sequence:CCGGCCCAAGTTAGTGACTGTGATTCTCGAGAATCACAGTCACTAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-1122s1c1
Sequence:CCGGCCTCCAACGAACCATTTCGTACTCGAGTACGAAATGGTTCGTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2667s1c1
Sequence:CCGGCCGAGGTTACAGGTAAACTAACTCGAGTTAGTTTACCTGTAACCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2408s1c1
Sequence:CCGGGCTGGTGTGATTACATACATACTCGAGTATGTATGTAATCACACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027539.3-2549s1c1
Sequence:CCGGGCCAAGGAGTTAATCAGTCAACTCGAGTTGACTGATTAACTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-1598s21c1
Sequence:CCGGGAGCCTCAGCTGCGAAGTATTCTCGAGAATACTTCGCAGCTGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027539.4-3343s21c1
Sequence:CCGGGAAATGCATTGGACGAATTAGCTCGAGCTAATTCGTCCAATGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-2571s21c1
Sequence:CCGGAGACTCTGCCAAGGAGTTAATCTCGAGATTAACTCCTTGGCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027539.4-1914s21c1
Sequence:CCGGCGGCAACTTCGCGGTAGTTAACTCGAGTTAACTACCGCGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040260
VALIDATED
DCLK2 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001040260.1-3057s1c1
Sequence:CCGGCCAGAGACAATGCTCAGTATTCTCGAGAATACTGAGCATTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001040260.1-3092s1c1
Sequence:CCGGCGATGGAAGAAGCCACTTCTTCTCGAGAAGAAGTGGCTTCTTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001040260.1-1174s1c1
Sequence:CCGGCAGATCTTCTTCCAATGTAAACTCGAGTTTACATTGGAAGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040260.2-937s21c1
Sequence:CCGGTGACTTTGTCCTGGATCATAGCTCGAGCTATGATCCAGGACAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040260.2-2594s21c1
Sequence:CCGGTGGTTCCTGGAGGCATCAAAGCTCGAGCTTTGATGCCTCCAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1079s21c1
Sequence:CCGGAGCCAACTTTCTACTCCTAAACTCGAGTTTAGGAGTAGAAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-542s21c1
Sequence:CCGGTCCAATGAACCATTTCGTAAACTCGAGTTTACGAAATGGTTCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-2654s21c1
Sequence:CCGGTTCCAGATCATCCCGTCATTTCTCGAGAAATGACGGGATGATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040260.2-1135s21c1
Sequence:CCGGAGGAAGTTTCAGAGGATTAAACTCGAGTTTAATCCTCTGAAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1524s21c1
Sequence:CCGGGAGATCTCTTTGATGCAATTACTCGAGTAATTGCATCAAAGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1985s21c1
Sequence:CCGGAGTCAAATGCTTCAGGTAAATCTCGAGATTTACCTGAAGCATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040260
VALIDATED
DCLK2 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001040260.1-3057s1c1
Sequence:CCGGCCAGAGACAATGCTCAGTATTCTCGAGAATACTGAGCATTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001040260.1-3092s1c1
Sequence:CCGGCGATGGAAGAAGCCACTTCTTCTCGAGAAGAAGTGGCTTCTTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001040260.1-1174s1c1
Sequence:CCGGCAGATCTTCTTCCAATGTAAACTCGAGTTTACATTGGAAGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040260.2-937s21c1
Sequence:CCGGTGACTTTGTCCTGGATCATAGCTCGAGCTATGATCCAGGACAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040260.2-2594s21c1
Sequence:CCGGTGGTTCCTGGAGGCATCAAAGCTCGAGCTTTGATGCCTCCAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1079s21c1
Sequence:CCGGAGCCAACTTTCTACTCCTAAACTCGAGTTTAGGAGTAGAAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-542s21c1
Sequence:CCGGTCCAATGAACCATTTCGTAAACTCGAGTTTACGAAATGGTTCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-2654s21c1
Sequence:CCGGTTCCAGATCATCCCGTCATTTCTCGAGAAATGACGGGATGATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040260.2-1135s21c1
Sequence:CCGGAGGAAGTTTCAGAGGATTAAACTCGAGTTTAATCCTCTGAAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1524s21c1
Sequence:CCGGGAGATCTCTTTGATGCAATTACTCGAGTAATTGCATCAAAGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1985s21c1
Sequence:CCGGAGTCAAATGCTTCAGGTAAATCTCGAGATTTACCTGAAGCATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040260
VALIDATED
DCLK2 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001040260.1-3057s1c1
Sequence:CCGGCCAGAGACAATGCTCAGTATTCTCGAGAATACTGAGCATTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195365    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001040260.1-3092s1c1
Sequence:CCGGCGATGGAAGAAGCCACTTCTTCTCGAGAAGAAGTGGCTTCTTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001040260.1-1174s1c1
Sequence:CCGGCAGATCTTCTTCCAATGTAAACTCGAGTTTACATTGGAAGAAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040260.2-937s21c1
Sequence:CCGGTGACTTTGTCCTGGATCATAGCTCGAGCTATGATCCAGGACAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040260.2-2594s21c1
Sequence:CCGGTGGTTCCTGGAGGCATCAAAGCTCGAGCTTTGATGCCTCCAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1079s21c1
Sequence:CCGGAGCCAACTTTCTACTCCTAAACTCGAGTTTAGGAGTAGAAAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-542s21c1
Sequence:CCGGTCCAATGAACCATTTCGTAAACTCGAGTTTACGAAATGGTTCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-2654s21c1
Sequence:CCGGTTCCAGATCATCCCGTCATTTCTCGAGAAATGACGGGATGATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040260.2-1135s21c1
Sequence:CCGGAGGAAGTTTCAGAGGATTAAACTCGAGTTTAATCCTCTGAAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1524s21c1
Sequence:CCGGGAGATCTCTTTGATGCAATTACTCGAGTAATTGCATCAAAGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040260.2-1985s21c1
Sequence:CCGGAGTCAAATGCTTCAGGTAAATCTCGAGATTTACCTGAAGCATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks