EMAIL THIS PAGE TO A FRIEND

DCLK3

doublecortin-like kinase 3

215 Gene Product Result for
Synonyms: CLR DCAMKL3 DCDC3C DCK3
UniProtKB ID: Q9C098
Gene ID:
Mouse(245038) doublecortin-like kinase 3
Rat(316023) doublecortin-like kinase 3
sheep(101114472) doublecortin-like kinase 3
naked mole-rat(101714327) doublecortin-like kinase 3
domestic guinea pig(100717951) doublecortin-like kinase 3
chicken(776499) doublecortin-like kinase 3
dog(485581) doublecortin-like kinase 3
domestic cat(101091806) doublecortin-like kinase 3
cow(507205) doublecortin-like kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033403 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_047355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_047355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_047355 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022081 MISSION® esiRNA esiRNA human DCLK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033403 Rosetta Predictions human pricing
XM_047355 Rosetta Predictions human pricing
XM_001076419 Rosetta Predictions rat pricing
XM_236661 Rosetta Predictions rat pricing
NM_172928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361286 predicted 512
2 SASI_Hs02_00361287 predicted 1954
3 SASI_Hs02_00361288 predicted 891
4 SASI_Hs02_00361289 predicted 2230
5 SASI_Hs02_00361290 predicted 1657
6 SASI_Hs02_00361291 predicted 2068
7 SASI_Hs02_00361292 predicted 2047
8 SASI_Hs02_00361293 predicted 1111
9 SASI_Hs02_00361294 predicted 1963
10 SASI_Hs02_00361295 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_047355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248500 predicted 2924
2 SASI_Hs01_00248501 predicted 943
3 SASI_Hs01_00248502 predicted 632
4 SASI_Hs01_00248503 predicted 2393
5 SASI_Hs01_00248504 predicted 1323
6 SASI_Hs01_00248505 predicted 2656
7 SASI_Hs01_00248506 predicted 2506
8 SASI_Hs01_00248507 predicted 2479
9 SASI_Hs01_00248508 predicted 674
10 SASI_Hs01_00248509 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353156 predicted 2007
2 SASI_Rn02_00353157 predicted 1835
3 SASI_Rn02_00353158 predicted 1321
4 SASI_Rn02_00353159 predicted 392
5 SASI_Rn02_00353160 predicted 1918
6 SASI_Rn02_00353161 predicted 298
7 SASI_Rn02_00353162 predicted 886
8 SASI_Rn02_00353163 predicted 688
9 SASI_Rn02_00353164 predicted 2263
10 SASI_Rn02_00353165 predicted 1972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390309 predicted 1328
2 SASI_Rn02_00390310 predicted 688
3 SASI_Rn02_00390311 predicted 1172
4 SASI_Rn02_00390312 predicted 391
5 SASI_Rn02_00390313 predicted 673
6 SASI_Rn02_00390314 predicted 302
7 SASI_Rn02_00390315 predicted 879
8 SASI_Rn02_00390316 predicted 683
9 SASI_Rn02_00390317 predicted 1391
10 SASI_Rn02_00390318 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140627 predicted 665
2 SASI_Mm01_00140628 predicted 1986
3 SASI_Mm01_00140629 predicted 2105
4 SASI_Mm01_00140630 predicted 846
5 SASI_Mm01_00140631 predicted 1987
6 SASI_Mm01_00140632 predicted 2348
7 SASI_Mm01_00140633 predicted 1046
8 SASI_Mm01_00140634 predicted 2457
9 SASI_Mm01_00140635 predicted 2235
10 SASI_Mm02_00344936 predicted 2175
11 SASI_Mm01_00140636 predicted 2523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033403
DCLK3 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033403.1-2752s21c1
Sequence:GTACCGGGGTGCTTACCAGGGTCTAAACCTCGAGGTTTAGACCCTGGTAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2165s21c1
Sequence:GTACCGGGGACCAGGACGAGCTCTTTAACTCGAGTTAAAGAGCTCGTCCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2043s21c1
Sequence:GTACCGGACTTACGTAGCTCCCGAAATTCTCGAGAATTTCGGGAGCTACGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-1632s21c1
Sequence:CCGGGCCTATGCGATGAAGATCATTCTCGAGAATGATCTTCATCGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033403.1-2552s21c1
Sequence:CCGGGGGAGAGACACTGAGTATATTCTCGAGAATATACTCAGTGTCTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-1970s21c1
Sequence:CCGGTACCTTGAAATTGGCTGATTTCTCGAGAAATCAGCCAATTTCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2003s21c1
Sequence:CCGGGCATGTGGTGAGACCTATATTCTCGAGAATATAGGTCTCACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2418s21c1
Sequence:CCGGGTTGTGGAGCAGGTATCATAGCTCGAGCTATGATACCTGCTCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033403
DCLK3 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033403.1-2752s21c1
Sequence:GTACCGGGGTGCTTACCAGGGTCTAAACCTCGAGGTTTAGACCCTGGTAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2165s21c1
Sequence:GTACCGGGGACCAGGACGAGCTCTTTAACTCGAGTTAAAGAGCTCGTCCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2043s21c1
Sequence:GTACCGGACTTACGTAGCTCCCGAAATTCTCGAGAATTTCGGGAGCTACGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-1632s21c1
Sequence:CCGGGCCTATGCGATGAAGATCATTCTCGAGAATGATCTTCATCGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033403.1-2552s21c1
Sequence:CCGGGGGAGAGACACTGAGTATATTCTCGAGAATATACTCAGTGTCTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-1970s21c1
Sequence:CCGGTACCTTGAAATTGGCTGATTTCTCGAGAAATCAGCCAATTTCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2003s21c1
Sequence:CCGGGCATGTGGTGAGACCTATATTCTCGAGAATATAGGTCTCACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2418s21c1
Sequence:CCGGGTTGTGGAGCAGGTATCATAGCTCGAGCTATGATACCTGCTCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033403
DCLK3 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033403.1-2752s21c1
Sequence:GTACCGGGGTGCTTACCAGGGTCTAAACCTCGAGGTTTAGACCCTGGTAAGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2165s21c1
Sequence:GTACCGGGGACCAGGACGAGCTCTTTAACTCGAGTTAAAGAGCTCGTCCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2043s21c1
Sequence:GTACCGGACTTACGTAGCTCCCGAAATTCTCGAGAATTTCGGGAGCTACGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-1632s21c1
Sequence:CCGGGCCTATGCGATGAAGATCATTCTCGAGAATGATCTTCATCGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033403.1-2552s21c1
Sequence:CCGGGGGAGAGACACTGAGTATATTCTCGAGAATATACTCAGTGTCTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-1970s21c1
Sequence:CCGGTACCTTGAAATTGGCTGATTTCTCGAGAAATCAGCCAATTTCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2003s21c1
Sequence:CCGGGCATGTGGTGAGACCTATATTCTCGAGAATATAGGTCTCACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033403.1-2418s21c1
Sequence:CCGGGTTGTGGAGCAGGTATCATAGCTCGAGCTATGATACCTGCTCCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172928
DCLK3 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172928.5-2587s21c1
Sequence:CCGGTGCAGAGCAGATGCCATAATCCTCGAGGATTATGGCATCTGCTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172928.5-2195s21c1
Sequence:CCGGGTGTGTGGGACGCCAACATATCTCGAGATATGTTGGCGTCCCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172928.5-2171s21c1
Sequence:CCGGTATGTGGTGAGGCCTATATTTCTCGAGAAATATAGGCCTCACCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-1800s1c1
Sequence:CCGGCTGAAGGGTAAGGAGGACATTCTCGAGAATGTCCTCCTTACCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-2383s1c1
Sequence:CCGGCCAAAGATCTGGTGAGAAATTCTCGAGAATTTCTCACCAGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-2022s1c1
Sequence:CCGGGTCCACATGCACGACAAGAATCTCGAGATTCTTGTCGTGCATGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-833s1c1
Sequence:CCGGAGGAAGCTATAGCGCGGAAATCTCGAGATTTCCGCGCTATAGCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-1680s1c1
Sequence:CCGGGTGGAGAAGCACTATGACATACTCGAGTATGTCATAGTGCTTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172928
DCLK3 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172928.5-2587s21c1
Sequence:CCGGTGCAGAGCAGATGCCATAATCCTCGAGGATTATGGCATCTGCTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172928.5-2195s21c1
Sequence:CCGGGTGTGTGGGACGCCAACATATCTCGAGATATGTTGGCGTCCCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172928.5-2171s21c1
Sequence:CCGGTATGTGGTGAGGCCTATATTTCTCGAGAAATATAGGCCTCACCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-1800s1c1
Sequence:CCGGCTGAAGGGTAAGGAGGACATTCTCGAGAATGTCCTCCTTACCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-2383s1c1
Sequence:CCGGCCAAAGATCTGGTGAGAAATTCTCGAGAATTTCTCACCAGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-2022s1c1
Sequence:CCGGGTCCACATGCACGACAAGAATCTCGAGATTCTTGTCGTGCATGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-833s1c1
Sequence:CCGGAGGAAGCTATAGCGCGGAAATCTCGAGATTTCCGCGCTATAGCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-1680s1c1
Sequence:CCGGGTGGAGAAGCACTATGACATACTCGAGTATGTCATAGTGCTTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172928
DCLK3 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172928.5-2587s21c1
Sequence:CCGGTGCAGAGCAGATGCCATAATCCTCGAGGATTATGGCATCTGCTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172928.5-2195s21c1
Sequence:CCGGGTGTGTGGGACGCCAACATATCTCGAGATATGTTGGCGTCCCACACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172928.5-2171s21c1
Sequence:CCGGTATGTGGTGAGGCCTATATTTCTCGAGAAATATAGGCCTCACCACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-1800s1c1
Sequence:CCGGCTGAAGGGTAAGGAGGACATTCTCGAGAATGTCCTCCTTACCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-2383s1c1
Sequence:CCGGCCAAAGATCTGGTGAGAAATTCTCGAGAATTTCTCACCAGATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-2022s1c1
Sequence:CCGGGTCCACATGCACGACAAGAATCTCGAGATTCTTGTCGTGCATGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-833s1c1
Sequence:CCGGAGGAAGCTATAGCGCGGAAATCTCGAGATTTCCGCGCTATAGCTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172928.1-1680s1c1
Sequence:CCGGGTGGAGAAGCACTATGACATACTCGAGTATGTCATAGTGCTTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_047355
VALIDATED
DCLK3 MISSION shRNA Bacterial Glycerol Stock
doublecortin-like kinase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-2471s1c1
Sequence:CCGGCTTACGTAGCTCCCGAAATTCCTCGAGGAATTTCGGGAGCTACGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-2533s1c1
Sequence:CCGGGCTGGCGTGATCCTCTATATCCTCGAGGATATAGAGGATCACGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-1158s1c1
Sequence:CCGGCGAGGAGCTTTCACTAGATGACTCGAGTCATCTAGTGAAAGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-615s1c1
Sequence:CCGGCCGTGTGAGGAAACTGTTTAACTCGAGTTAAACAGTTTCCTCACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047355.7-1840s1c1
Sequence:CCGGGCCTATGCGATGAAGATCATTCTCGAGAATGATCTTCATCGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-1094s1c1
Sequence:CCGGCCTCGGGTGAAATTATCAGATCTCGAGATCTGATAATTTCACCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-2263s1c1
Sequence:CCGGCCCGAAATTCTTTCTGAGAAACTCGAGTTTCTCAGAAAGAATTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-5034s1c1
Sequence:CCGGCCCAGCAGAAATTCAAGCATACTCGAGTATGCTTGAATTTCTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_047355
VALIDATED
DCLK3 MISSION shRNA shRNA Plasmid DNA
doublecortin-like kinase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-2471s1c1
Sequence:CCGGCTTACGTAGCTCCCGAAATTCCTCGAGGAATTTCGGGAGCTACGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-2533s1c1
Sequence:CCGGGCTGGCGTGATCCTCTATATCCTCGAGGATATAGAGGATCACGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-1158s1c1
Sequence:CCGGCGAGGAGCTTTCACTAGATGACTCGAGTCATCTAGTGAAAGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-615s1c1
Sequence:CCGGCCGTGTGAGGAAACTGTTTAACTCGAGTTAAACAGTTTCCTCACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047355.7-1840s1c1
Sequence:CCGGGCCTATGCGATGAAGATCATTCTCGAGAATGATCTTCATCGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-1094s1c1
Sequence:CCGGCCTCGGGTGAAATTATCAGATCTCGAGATCTGATAATTTCACCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-2263s1c1
Sequence:CCGGCCCGAAATTCTTTCTGAGAAACTCGAGTTTCTCAGAAAGAATTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-5034s1c1
Sequence:CCGGCCCAGCAGAAATTCAAGCATACTCGAGTATGCTTGAATTTCTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_047355
VALIDATED
DCLK3 MISSION shRNA Lentiviral Transduction Particles
doublecortin-like kinase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-2471s1c1
Sequence:CCGGCTTACGTAGCTCCCGAAATTCCTCGAGGAATTTCGGGAGCTACGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-2533s1c1
Sequence:CCGGGCTGGCGTGATCCTCTATATCCTCGAGGATATAGAGGATCACGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_047355.9-1158s1c1
Sequence:CCGGCGAGGAGCTTTCACTAGATGACTCGAGTCATCTAGTGAAAGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-615s1c1
Sequence:CCGGCCGTGTGAGGAAACTGTTTAACTCGAGTTAAACAGTTTCCTCACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047355.7-1840s1c1
Sequence:CCGGGCCTATGCGATGAAGATCATTCTCGAGAATGATCTTCATCGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-1094s1c1
Sequence:CCGGCCTCGGGTGAAATTATCAGATCTCGAGATCTGATAATTTCACCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-2263s1c1
Sequence:CCGGCCCGAAATTCTTTCTGAGAAACTCGAGTTTCTCAGAAAGAATTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_047355.7-5034s1c1
Sequence:CCGGCCCAGCAGAAATTCAAGCATACTCGAGTATGCTTGAATTTCTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks