EMAIL THIS PAGE TO A FRIEND

DCLRE1A

DNA cross-link repair 1A

51 Gene Product Result for
Synonyms: PSO2 SNM1 SNM1A
UniProtKB ID: Q6PJP8, D3DRC1, Q14701, Q6P5Y3, Q6PKL4
Gene ID:
Human(9937) Summary: This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(55947) DNA cross-link repair 1A, PSO2 homolog (S. cerevisiae)
Rat(292127) DNA cross-link repair 1A
Zebrafish(324964) DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)
chicken(423902) DNA cross-link repair 1A
cow(504377) DNA cross-link repair 1A
Horse(100068217) DNA cross-link repair 1A
domestic cat(101096110) DNA cross-link repair 1A
dog(477824) DNA cross-link repair 1A
domestic guinea pig(100723290) DNA cross-link repair 1A
naked mole-rat(101708258) DNA cross-link repair 1A
sheep(101123252) DNA cross-link repair 1A
Domestic Rabbit(100359072) DNA cross-link repair 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014881 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102221 MISSION® esiRNA esiRNA human DCLRE1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014881 Rosetta Predictions human pricing
NM_001106201 Rosetta Predictions rat pricing
NM_018831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086180 predicted 2874
2 SASI_Hs01_00086181 predicted 3557
3 SASI_Hs01_00086182 predicted 3383
4 SASI_Hs01_00086183 predicted 1751
5 SASI_Hs02_00346499 predicted 2302
6 SASI_Hs01_00086185 predicted 3786
7 SASI_Hs01_00086186 predicted 1312
8 SASI_Hs01_00086187 predicted 1288
9 SASI_Hs01_00086188 predicted 1785
10 SASI_Hs01_00086189 predicted 2916
11 SASI_Hs01_00086184 predicted 3796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216628 predicted 2918
2 SASI_Rn02_00216629 predicted 2321
3 SASI_Rn02_00216630 predicted 2697
4 SASI_Rn02_00216631 predicted 1628
5 SASI_Rn02_00216632 predicted 3229
6 SASI_Rn02_00216633 predicted 3131
7 SASI_Rn02_00216634 predicted 1735
8 SASI_Rn02_00216635 predicted 1077
9 SASI_Rn02_00216636 predicted 2814
10 SASI_Rn02_00216637 predicted 2907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324187 predicted 3145
2 SASI_Mm02_00324188 predicted 1509
3 SASI_Mm01_00162115 predicted 3249
4 SASI_Mm01_00162117 predicted 1329
5 SASI_Mm01_00162118 predicted 3273
6 SASI_Mm01_00162119 predicted 1112
7 SASI_Mm01_00162121 predicted 3455
8 SASI_Mm01_00162122 predicted 2879
9 SASI_Mm02_00324189 predicted 1524
10 SASI_Mm02_00324190 predicted 3741
11 SASI_Mm01_00162116 predicted 993
12 SASI_Mm01_00162120 predicted 2322
13 SASI_Mm01_00162123 predicted 3020
14 SASI_Mm01_00162124 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014881
VALIDATED
DCLRE1A MISSION shRNA Bacterial Glycerol Stock
DNA cross-link repair 1A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014881.2-874s1c1
Sequence:CCGGGCAGGTTGTCAGACTTCTGTTCTCGAGAACAGAAGTCTGACAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014881.2-3964s1c1
Sequence:CCGGGCATCATCAAGGATAACTGAACTCGAGTTCAGTTATCCTTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014881.2-3887s1c1
Sequence:CCGGCCTCATGAAGATTGTTCAGATCTCGAGATCTGAACAATCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014881.2-3799s1c1
Sequence:CCGGCGAGGATTCAGTAGTAGTTAACTCGAGTTAACTACTACTGAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014881.2-999s1c1
Sequence:CCGGCCCAAAGATACGTCCAGTTTACTCGAGTAAACTGGACGTATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014881.2-2796s1c1
Sequence:CCGGCGGCTTTACAGTTGATGCCTTCTCGAGAAGGCATCAACTGTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2644s21c1
Sequence:CCGGGAATCTGAAGCAGTCAATTTACTCGAGTAAATTGACTGCTTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2249s21c1
Sequence:CCGGGTACACCTGCTCCGAAGTATTCTCGAGAATACTTCGGAGCAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2619s21c1
Sequence:CCGGGAGATCAGATCACCTTATTAACTCGAGTTAATAAGGTGATCTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-4022s21c1
Sequence:CCGGGCCCTCCATGGGCAGTTATATCTCGAGATATAACTGCCCATGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-1335s21c1
Sequence:CCGGGGTTTCAAATGATCCCTTATTCTCGAGAATAAGGGATCATTTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014881
VALIDATED
DCLRE1A MISSION shRNA shRNA Plasmid DNA
DNA cross-link repair 1A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014881.2-874s1c1
Sequence:CCGGGCAGGTTGTCAGACTTCTGTTCTCGAGAACAGAAGTCTGACAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014881.2-3964s1c1
Sequence:CCGGGCATCATCAAGGATAACTGAACTCGAGTTCAGTTATCCTTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014881.2-3887s1c1
Sequence:CCGGCCTCATGAAGATTGTTCAGATCTCGAGATCTGAACAATCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014881.2-3799s1c1
Sequence:CCGGCGAGGATTCAGTAGTAGTTAACTCGAGTTAACTACTACTGAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014881.2-999s1c1
Sequence:CCGGCCCAAAGATACGTCCAGTTTACTCGAGTAAACTGGACGTATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014881.2-2796s1c1
Sequence:CCGGCGGCTTTACAGTTGATGCCTTCTCGAGAAGGCATCAACTGTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2644s21c1
Sequence:CCGGGAATCTGAAGCAGTCAATTTACTCGAGTAAATTGACTGCTTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2249s21c1
Sequence:CCGGGTACACCTGCTCCGAAGTATTCTCGAGAATACTTCGGAGCAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2619s21c1
Sequence:CCGGGAGATCAGATCACCTTATTAACTCGAGTTAATAAGGTGATCTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-4022s21c1
Sequence:CCGGGCCCTCCATGGGCAGTTATATCTCGAGATATAACTGCCCATGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-1335s21c1
Sequence:CCGGGGTTTCAAATGATCCCTTATTCTCGAGAATAAGGGATCATTTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014881
VALIDATED
DCLRE1A MISSION shRNA Lentiviral Transduction Particles
DNA cross-link repair 1A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014881.2-874s1c1
Sequence:CCGGGCAGGTTGTCAGACTTCTGTTCTCGAGAACAGAAGTCTGACAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014881.2-3964s1c1
Sequence:CCGGGCATCATCAAGGATAACTGAACTCGAGTTCAGTTATCCTTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014881.2-3887s1c1
Sequence:CCGGCCTCATGAAGATTGTTCAGATCTCGAGATCTGAACAATCTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014881.2-3799s1c1
Sequence:CCGGCGAGGATTCAGTAGTAGTTAACTCGAGTTAACTACTACTGAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014881.2-999s1c1
Sequence:CCGGCCCAAAGATACGTCCAGTTTACTCGAGTAAACTGGACGTATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014881.2-2796s1c1
Sequence:CCGGCGGCTTTACAGTTGATGCCTTCTCGAGAAGGCATCAACTGTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2644s21c1
Sequence:CCGGGAATCTGAAGCAGTCAATTTACTCGAGTAAATTGACTGCTTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2249s21c1
Sequence:CCGGGTACACCTGCTCCGAAGTATTCTCGAGAATACTTCGGAGCAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-2619s21c1
Sequence:CCGGGAGATCAGATCACCTTATTAACTCGAGTTAATAAGGTGATCTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-4022s21c1
Sequence:CCGGGCCCTCCATGGGCAGTTATATCTCGAGATATAACTGCCCATGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014881.2-1335s21c1
Sequence:CCGGGGTTTCAAATGATCCCTTATTCTCGAGAATAAGGGATCATTTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018831
VALIDATED
DCLRE1A MISSION shRNA Bacterial Glycerol Stock
DNA cross-link repair 1A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-1725s1c1
Sequence:CCGGCCAACCGTCTAAGAAAGTAATCTCGAGATTACTTTCTTAGACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-2317s1c1
Sequence:CCGGCCAGTCTATTGCAGCGAGATACTCGAGTATCTCGCTGCAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-850s1c1
Sequence:CCGGGCTGAAATCAACAGGAAGAATCTCGAGATTCTTCCTGTTGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-465s1c1
Sequence:CCGGGCGCCCTGTTTATGATGGATACTCGAGTATCCATCATAAACAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-3235s1c1
Sequence:CCGGGCGGCGATAATGAAATCTAAACTCGAGTTTAGATTTCATTATCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018831.3-3787s21c1
Sequence:CCGGGCGGCGATAATGAAATCTAAACTCGAGTTTAGATTTCATTATCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-3859s21c1
Sequence:CCGGCCTCGCTTTGAACAGTGATACCTCGAGGTATCACTGTTCAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-2869s21c1
Sequence:CCGGCCAGTCTATTGCAGCGAGATACTCGAGTATCTCGCTGCAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018831.3-1387s21c1
Sequence:CCGGGCTGAAATCAACAGGAAGAATCTCGAGATTCTTCCTGTTGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-1002s21c1
Sequence:CCGGGCGCCCTGTTTATGATGGATACTCGAGTATCCATCATAAACAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-2271s21c1
Sequence:CCGGCCAACCGTCTAAGAAAGTAATCTCGAGATTACTTTCTTAGACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018831
VALIDATED
DCLRE1A MISSION shRNA shRNA Plasmid DNA
DNA cross-link repair 1A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-1725s1c1
Sequence:CCGGCCAACCGTCTAAGAAAGTAATCTCGAGATTACTTTCTTAGACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-2317s1c1
Sequence:CCGGCCAGTCTATTGCAGCGAGATACTCGAGTATCTCGCTGCAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-850s1c1
Sequence:CCGGGCTGAAATCAACAGGAAGAATCTCGAGATTCTTCCTGTTGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-465s1c1
Sequence:CCGGGCGCCCTGTTTATGATGGATACTCGAGTATCCATCATAAACAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-3235s1c1
Sequence:CCGGGCGGCGATAATGAAATCTAAACTCGAGTTTAGATTTCATTATCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018831.3-3787s21c1
Sequence:CCGGGCGGCGATAATGAAATCTAAACTCGAGTTTAGATTTCATTATCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-3859s21c1
Sequence:CCGGCCTCGCTTTGAACAGTGATACCTCGAGGTATCACTGTTCAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-2869s21c1
Sequence:CCGGCCAGTCTATTGCAGCGAGATACTCGAGTATCTCGCTGCAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018831.3-1387s21c1
Sequence:CCGGGCTGAAATCAACAGGAAGAATCTCGAGATTCTTCCTGTTGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-1002s21c1
Sequence:CCGGGCGCCCTGTTTATGATGGATACTCGAGTATCCATCATAAACAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-2271s21c1
Sequence:CCGGCCAACCGTCTAAGAAAGTAATCTCGAGATTACTTTCTTAGACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018831
VALIDATED
DCLRE1A MISSION shRNA Lentiviral Transduction Particles
DNA cross-link repair 1A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-1725s1c1
Sequence:CCGGCCAACCGTCTAAGAAAGTAATCTCGAGATTACTTTCTTAGACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-2317s1c1
Sequence:CCGGCCAGTCTATTGCAGCGAGATACTCGAGTATCTCGCTGCAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-850s1c1
Sequence:CCGGGCTGAAATCAACAGGAAGAATCTCGAGATTCTTCCTGTTGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-465s1c1
Sequence:CCGGGCGCCCTGTTTATGATGGATACTCGAGTATCCATCATAAACAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018831.2-3235s1c1
Sequence:CCGGGCGGCGATAATGAAATCTAAACTCGAGTTTAGATTTCATTATCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018831.3-3787s21c1
Sequence:CCGGGCGGCGATAATGAAATCTAAACTCGAGTTTAGATTTCATTATCGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-3859s21c1
Sequence:CCGGCCTCGCTTTGAACAGTGATACCTCGAGGTATCACTGTTCAAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-2869s21c1
Sequence:CCGGCCAGTCTATTGCAGCGAGATACTCGAGTATCTCGCTGCAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018831.3-1387s21c1
Sequence:CCGGGCTGAAATCAACAGGAAGAATCTCGAGATTCTTCCTGTTGATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-1002s21c1
Sequence:CCGGGCGCCCTGTTTATGATGGATACTCGAGTATCCATCATAAACAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018831.3-2271s21c1
Sequence:CCGGCCAACCGTCTAAGAAAGTAATCTCGAGATTACTTTCTTAGACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks