EMAIL THIS PAGE TO A FRIEND

DCLRE1B

DNA cross-link repair 1B

185 Gene Product Result for
Synonyms: APOLLO SNM1B SNMIB
UniProtKB ID: Q9H816, Q9H9E5
Gene ID:
Human(64858) Summary: DNA interstrand cross-links prevent strand separation, thereby physically blocking transcription, replication, and segregation of DNA. DCLRE1B is one of several evolutionarily conserved genes involved in repair of interstrand cross-links (Dronkert et al., 2000 [PubMed 10848582]
Mouse(140917) DNA cross-link repair 1B, PSO2 homolog (S. cerevisiae)
Rat(310745) DNA cross-link repair 1B
sheep(101121133) DNA cross-link repair 1B
Domestic Rabbit(100354044) DNA cross-link repair 1B
naked mole-rat(101714533) DNA cross-link repair 1B
domestic guinea pig(100729313) DNA cross-link repair 1B
Zebrafish(768137) DNA cross-link repair 1B
chicken(428269) DNA cross-link repair 1B
cow(539794) DNA cross-link repair 1B
Horse(100065015) DNA cross-link repair 1B
domestic cat(101082172) DNA cross-link repair 1B
dog(606778) DNA cross-link repair 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022836 Rosetta Predictions human pricing
NM_001025687 Rosetta Predictions rat pricing
NM_001025312 Rosetta Predictions mouse pricing
NM_133865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202934 predicted 1367
2 SASI_Hs01_00202935 predicted 575
3 SASI_Hs02_00356152 predicted 679
4 SASI_Hs01_00202936 predicted 1393
5 SASI_Hs01_00202937 predicted 1709
6 SASI_Hs01_00202939 predicted 854
7 SASI_Hs01_00202940 predicted 453
8 SASI_Hs01_00202941 predicted 1141
9 SASI_Hs01_00202942 predicted 1184
10 SASI_Hs02_00356153 predicted 1403
11 SASI_Hs01_00202938 predicted 593
12 SASI_Hs01_00202943 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049334 predicted 491
2 SASI_Rn01_00049335 predicted 527
3 SASI_Rn01_00049336 predicted 336
4 SASI_Rn01_00049337 predicted 879
5 SASI_Rn02_00203294 predicted 1213
6 SASI_Rn01_00049338 predicted 1080
7 SASI_Rn01_00049339 predicted 1049
8 SASI_Rn01_00049340 predicted 470
9 SASI_Rn01_00049341 predicted 684
10 SASI_Rn01_00049342 predicted 674
11 SASI_Rn01_00049343 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153864 predicted 928
2 SASI_Mm01_00153866 predicted 700
3 SASI_Mm01_00153867 predicted 1357
4 SASI_Mm01_00153868 predicted 1530
5 SASI_Mm01_00153869 predicted 1209
6 SASI_Mm01_00153870 predicted 1031
7 SASI_Mm01_00153871 predicted 778
8 SASI_Mm01_00153872 predicted 1505
9 SASI_Mm01_00153873 predicted 1673
10 SASI_Mm02_00287829 predicted 1430
11 SASI_Mm01_00153865 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199371 predicted 1089
2 SASI_Mm01_00199373 predicted 868
3 SASI_Mm01_00199374 predicted 1523
4 SASI_Mm01_00199375 predicted 1700
5 SASI_Mm01_00199376 predicted 1376
6 SASI_Mm01_00199377 predicted 1205
7 SASI_Mm01_00199378 predicted 939
8 SASI_Mm01_00199379 predicted 1674
9 SASI_Mm01_00199380 predicted 1843
10 SASI_Mm02_00338921 predicted 1593
11 SASI_Mm01_00199372 predicted 1339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022836
VALIDATED
DCLRE1B MISSION shRNA Bacterial Glycerol Stock
DNA cross-link repair 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022836.2-577s21c1
Sequence:CCGGGGGAAACAGATCCATACTTTACTCGAGTAAAGTATGGATCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022836.2-1480s21c1
Sequence:CCGGTCTACAGATGAGGAGTTTATTCTCGAGAATAAACTCCTCATCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022836.2-1242s21c1
Sequence:CCGGTGAGGAAAGTGCTGATCAATCCTCGAGGATTGATCAGCACTTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022836.2-349s21c1
Sequence:CCGGCGTCACCTACAGGTATCTAAGCTCGAGCTTAGATACCTGTAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022836.2-3042s21c1
Sequence:CCGGAGTCTCCCAACGTCCTATTAGCTCGAGCTAATAGGACGTTGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022836.2-1376s1c1
Sequence:CCGGCAGATCTCTATAGCAAAGAATCTCGAGATTCTTTGCTATAGAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022836.2-854s1c1
Sequence:CCGGGCATCCATGCAGTAGACCATACTCGAGTATGGTCTACTGCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022836.2-2905s1c1
Sequence:CCGGGCAGTGAAGAAGATTCCATTTCTCGAGAAATGGAATCTTCTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022836.2-1185s1c1
Sequence:CCGGGCTGTTAGAAAGGAGGCTAAACTCGAGTTTAGCCTCCTTTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022836.2-687s1c1
Sequence:CCGGCCCACAACATAACATAAAGATCTCGAGATCTTTATGTTATGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022836
VALIDATED
DCLRE1B MISSION shRNA shRNA Plasmid DNA
DNA cross-link repair 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022836.2-577s21c1
Sequence:CCGGGGGAAACAGATCCATACTTTACTCGAGTAAAGTATGGATCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022836.2-1480s21c1
Sequence:CCGGTCTACAGATGAGGAGTTTATTCTCGAGAATAAACTCCTCATCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022836.2-1242s21c1
Sequence:CCGGTGAGGAAAGTGCTGATCAATCCTCGAGGATTGATCAGCACTTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022836.2-349s21c1
Sequence:CCGGCGTCACCTACAGGTATCTAAGCTCGAGCTTAGATACCTGTAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022836.2-3042s21c1
Sequence:CCGGAGTCTCCCAACGTCCTATTAGCTCGAGCTAATAGGACGTTGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022836.2-1376s1c1
Sequence:CCGGCAGATCTCTATAGCAAAGAATCTCGAGATTCTTTGCTATAGAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022836.2-854s1c1
Sequence:CCGGGCATCCATGCAGTAGACCATACTCGAGTATGGTCTACTGCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022836.2-2905s1c1
Sequence:CCGGGCAGTGAAGAAGATTCCATTTCTCGAGAAATGGAATCTTCTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022836.2-1185s1c1
Sequence:CCGGGCTGTTAGAAAGGAGGCTAAACTCGAGTTTAGCCTCCTTTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022836.2-687s1c1
Sequence:CCGGCCCACAACATAACATAAAGATCTCGAGATCTTTATGTTATGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022836
VALIDATED
DCLRE1B MISSION shRNA Lentiviral Transduction Particles
DNA cross-link repair 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022836.2-577s21c1
Sequence:CCGGGGGAAACAGATCCATACTTTACTCGAGTAAAGTATGGATCTGTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022836.2-1480s21c1
Sequence:CCGGTCTACAGATGAGGAGTTTATTCTCGAGAATAAACTCCTCATCTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022836.2-1242s21c1
Sequence:CCGGTGAGGAAAGTGCTGATCAATCCTCGAGGATTGATCAGCACTTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022836.2-349s21c1
Sequence:CCGGCGTCACCTACAGGTATCTAAGCTCGAGCTTAGATACCTGTAGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022836.2-3042s21c1
Sequence:CCGGAGTCTCCCAACGTCCTATTAGCTCGAGCTAATAGGACGTTGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022836.2-1376s1c1
Sequence:CCGGCAGATCTCTATAGCAAAGAATCTCGAGATTCTTTGCTATAGAGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022836.2-854s1c1
Sequence:CCGGGCATCCATGCAGTAGACCATACTCGAGTATGGTCTACTGCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022836.2-2905s1c1
Sequence:CCGGGCAGTGAAGAAGATTCCATTTCTCGAGAAATGGAATCTTCTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022836.2-1185s1c1
Sequence:CCGGGCTGTTAGAAAGGAGGCTAAACTCGAGTTTAGCCTCCTTTCTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022836.2-687s1c1
Sequence:CCGGCCCACAACATAACATAAAGATCTCGAGATCTTTATGTTATGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133865
VALIDATED
DCLRE1B MISSION shRNA Bacterial Glycerol Stock
DNA cross-link repair 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133865.1-180s1c1
Sequence:CCGGCTTTGTATCTAGACAACACTACTCGAGTAGTGTTGTCTAGATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133865.1-83s1c1
Sequence:CCGGGAAGGATACTTTGGAACAATTCTCGAGAATTGTTCCAAAGTATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-836s1c1
Sequence:CCGGGAGAAAGCTAATCAGGTTAAACTCGAGTTTAACCTGATTAGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-317s1c1
Sequence:CCGGGAATCACTGCTGGAGCAACTACTCGAGTAGTTGCTCCAGCAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-807s1c1
Sequence:CCGGCTCAGGGTGTTGTGTTTGAATCTCGAGATTCAAACACAACACCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133865
VALIDATED
DCLRE1B MISSION shRNA shRNA Plasmid DNA
DNA cross-link repair 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133865.1-180s1c1
Sequence:CCGGCTTTGTATCTAGACAACACTACTCGAGTAGTGTTGTCTAGATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133865.1-83s1c1
Sequence:CCGGGAAGGATACTTTGGAACAATTCTCGAGAATTGTTCCAAAGTATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-836s1c1
Sequence:CCGGGAGAAAGCTAATCAGGTTAAACTCGAGTTTAACCTGATTAGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-317s1c1
Sequence:CCGGGAATCACTGCTGGAGCAACTACTCGAGTAGTTGCTCCAGCAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-807s1c1
Sequence:CCGGCTCAGGGTGTTGTGTTTGAATCTCGAGATTCAAACACAACACCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133865
VALIDATED
DCLRE1B MISSION shRNA Lentiviral Transduction Particles
DNA cross-link repair 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133865.1-180s1c1
Sequence:CCGGCTTTGTATCTAGACAACACTACTCGAGTAGTGTTGTCTAGATACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133865.1-83s1c1
Sequence:CCGGGAAGGATACTTTGGAACAATTCTCGAGAATTGTTCCAAAGTATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-836s1c1
Sequence:CCGGGAGAAAGCTAATCAGGTTAAACTCGAGTTTAACCTGATTAGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-317s1c1
Sequence:CCGGGAATCACTGCTGGAGCAACTACTCGAGTAGTTGCTCCAGCAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133865.1-807s1c1
Sequence:CCGGCTCAGGGTGTTGTGTTTGAATCTCGAGATTCAAACACAACACCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks