EMAIL THIS PAGE TO A FRIEND

DCLRE1C

DNA cross-link repair 1C

130 Gene Product Result for
Synonyms: A-SCID DCLREC1C RS-SCID SCIDA SNM1C hSNM1C
Gene ID:
Human(64421) Summary: This gene encodes a nuclear protein that is involved in V(D)J recombination and DNA repair. The protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins when complexed with protein kinase, DNA-activated, catalytic polypeptide. Mutations in this gene cause Athabascan-type severe combined immunodeficiency (SCIDA). [provided by RefSeq, Jul 2008]
Mouse(227525) DNA cross-link repair 1C, PSO2 homolog (S. cerevisiae)
Rat(259171) DNA cross-link repair 1C
Zebrafish(566285) DNA cross-link repair 1C, PSO2 homolog (S. cerevisiae)
dog(487123) DNA cross-link repair 1C
cow(517886) DNA cross-link repair 1C
Horse(100056337) DNA cross-link repair 1C
domestic cat(101089021) DNA cross-link repair 1C
chicken(430764) DNA cross-link repair 1C
domestic guinea pig(100716630) DNA cross-link repair 1C
naked mole-rat(101700859) DNA cross-link repair 1C
sheep(101108937) DNA cross-link repair 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022487 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033855 Rosetta Predictions human pricing
NM_001033857 Rosetta Predictions human pricing
NM_001033858 Rosetta Predictions human pricing
NM_022487 Rosetta Predictions human pricing
NM_147145 Rosetta Predictions rat pricing
NM_001110214 Rosetta Predictions mouse pricing
NM_146114 Rosetta Predictions mouse pricing
NM_175683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014423 predicted 1131
2 SASI_Hs01_00014424 predicted 1273
3 SASI_Hs01_00014425 predicted 1804
4 SASI_Hs01_00014426 predicted 915
5 SASI_Hs02_00308088 predicted 1009
6 SASI_Hs01_00014430 predicted 777
7 SASI_Hs01_00014431 predicted 1651
8 SASI_Hs01_00014432 predicted 906
9 SASI_Hs02_00308089 predicted 1087
10 SASI_Hs02_00308090 predicted 1688
11 SASI_Hs01_00014427 predicted 1927
12 SASI_Hs01_00014428 predicted 1254
13 SASI_Hs01_00014429 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148365 predicted 1223
2 SASI_Hs01_00148366 predicted 1355
3 SASI_Hs01_00148367 predicted 1892
4 SASI_Hs01_00148368 predicted 999
5 SASI_Hs02_00308091 predicted 1088
6 SASI_Hs01_00148372 predicted 862
7 SASI_Hs01_00148373 predicted 1732
8 SASI_Hs01_00148374 predicted 991
9 SASI_Hs02_00308092 predicted 1168
10 SASI_Hs02_00308093 predicted 1769
11 SASI_Hs01_00148369 predicted 2015
12 SASI_Hs01_00148370 predicted 1342
13 SASI_Hs01_00148371 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209716 predicted 1536
2 SASI_Hs01_00209717 predicted 1674
3 SASI_Hs01_00209718 predicted 2212
4 SASI_Hs01_00209719 predicted 1320
5 SASI_Hs02_00308094 predicted 1413
6 SASI_Hs01_00209723 predicted 1177
7 SASI_Hs01_00209724 predicted 2060
8 SASI_Hs01_00209725 predicted 1315
9 SASI_Hs02_00308095 predicted 1496
10 SASI_Hs02_00308096 predicted 2092
11 SASI_Hs01_00209720 predicted 2339
12 SASI_Hs01_00209721 predicted 1666
13 SASI_Hs01_00209722 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155089 predicted 1078
2 SASI_Hs01_00155090 predicted 1219
3 SASI_Hs01_00155091 predicted 1754
4 SASI_Hs01_00155092 predicted 858
5 SASI_Hs02_00355781 predicted 945
6 SASI_Hs01_00155096 predicted 717
7 SASI_Hs01_00155097 predicted 1597
8 SASI_Hs01_00155098 predicted 850
9 SASI_Hs02_00355782 predicted 1035
10 SASI_Hs02_00355783 predicted 1627
11 SASI_Hs01_00155093 predicted 1870
12 SASI_Hs01_00155094 predicted 1195
13 SASI_Hs01_00155095 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094179 predicted 1634
2 SASI_Rn01_00094180 predicted 255
3 SASI_Rn01_00094181 predicted 1332
4 SASI_Rn01_00094182 predicted 1826
5 SASI_Rn01_00094184 predicted 494
6 SASI_Rn02_00268856 predicted 323
7 SASI_Rn01_00094185 predicted 397
8 SASI_Rn01_00094186 predicted 1473
9 SASI_Rn01_00094187 predicted 1348
10 SASI_Rn02_00268857 predicted 224
11 SASI_Rn01_00094183 predicted 229
12 SASI_Rn01_00094188 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304976 predicted 357
2 SASI_Mm02_00304977 predicted 793
3 SASI_Mm02_00304978 predicted 579
4 SASI_Mm02_00304979 predicted 261
5 SASI_Mm02_00304980 predicted 703
6 SASI_Mm02_00304981 predicted 461
7 SASI_Mm02_00304982 predicted 287
8 SASI_Mm02_00304983 predicted 555
9 SASI_Mm02_00304984 predicted 396
10 SASI_Mm02_00304985 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341769 predicted 1922
2 SASI_Mm02_00341770 predicted 1719
3 SASI_Mm02_00341771 predicted 1835
4 SASI_Mm02_00341772 predicted 799
5 SASI_Mm02_00341773 predicted 257
6 SASI_Mm02_00341774 predicted 1579
7 SASI_Mm02_00341775 predicted 1637
8 SASI_Mm02_00341776 predicted 712
9 SASI_Mm02_00341777 predicted 458
10 SASI_Mm01_00050385 predicted 970
11 SASI_Mm01_00050386 predicted 1254
12 SASI_Mm01_00050387 predicted 1270
13 SASI_Mm01_00050388 predicted 934
14 SASI_Mm01_00050389 predicted 1258
15 SASI_Mm01_00050390 predicted 1353
16 SASI_Mm01_00050391 predicted 1113
17 SASI_Mm01_00050392 predicted 1203
18 SASI_Mm01_00050393 predicted 1200
19 SASI_Mm01_00050394 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346616 predicted 356
2 SASI_Mm01_00061448 predicted 797
3 SASI_Mm02_00346617 predicted 586
4 SASI_Mm01_00061449 predicted 257
5 SASI_Mm01_00061451 predicted 706
6 SASI_Mm01_00061452 predicted 460
7 SASI_Mm01_00061453 predicted 285
8 SASI_Mm02_00346618 predicted 555
9 SASI_Mm01_00061455 predicted 397
10 SASI_Mm02_00346619 predicted 275
11 SASI_Mm01_00061446 predicted 1535
12 SASI_Mm01_00061447 predicted 525
13 SASI_Mm01_00061450 predicted 921
14 SASI_Mm01_00061454 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146114
DCLRE1C MISSION shRNA Bacterial Glycerol Stock
DNA cross-link repair 1C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-97s1c1
Sequence:CCGGGAGTATCCAACCATCTCCATTCTCGAGAATGGAGATGGTTGGATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146114.1-2287s1c1
Sequence:CCGGCCTTTCGATGTTGCAATACAACTCGAGTTGTATTGCAACATCGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-1402s1c1
Sequence:CCGGGCTAACTTCATAGACTGTGAACTCGAGTTCACAGTCTATGAAGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-880s1c1
Sequence:CCGGCCCTGTGGTATAACTTCCCAACTCGAGTTGGGAAGTTATACCACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-1879s1c1
Sequence:CCGGGCCTCTCAAATAGAACAGGATCTCGAGATCCTGTTCTATTTGAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146114.1-2233s1c1
Sequence:CCGGCAACAACAACAACAACAGAAACTCGAGTTTCTGTTGTTGTTGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-694s1c1
Sequence:CCGGGCTTATGGCTACGAGTATTTACTCGAGTAAATACTCGTAGCCATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-1169s1c1
Sequence:CCGGCAAAGTACAAACCGCTTGGAACTCGAGTTCCAAGCGGTTTGTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146114
DCLRE1C MISSION shRNA shRNA Plasmid DNA
DNA cross-link repair 1C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-97s1c1
Sequence:CCGGGAGTATCCAACCATCTCCATTCTCGAGAATGGAGATGGTTGGATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146114.1-2287s1c1
Sequence:CCGGCCTTTCGATGTTGCAATACAACTCGAGTTGTATTGCAACATCGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-1402s1c1
Sequence:CCGGGCTAACTTCATAGACTGTGAACTCGAGTTCACAGTCTATGAAGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-880s1c1
Sequence:CCGGCCCTGTGGTATAACTTCCCAACTCGAGTTGGGAAGTTATACCACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-1879s1c1
Sequence:CCGGGCCTCTCAAATAGAACAGGATCTCGAGATCCTGTTCTATTTGAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146114.1-2233s1c1
Sequence:CCGGCAACAACAACAACAACAGAAACTCGAGTTTCTGTTGTTGTTGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-694s1c1
Sequence:CCGGGCTTATGGCTACGAGTATTTACTCGAGTAAATACTCGTAGCCATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-1169s1c1
Sequence:CCGGCAAAGTACAAACCGCTTGGAACTCGAGTTCCAAGCGGTTTGTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146114
DCLRE1C MISSION shRNA Lentiviral Transduction Particles
DNA cross-link repair 1C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-97s1c1
Sequence:CCGGGAGTATCCAACCATCTCCATTCTCGAGAATGGAGATGGTTGGATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146114.1-2287s1c1
Sequence:CCGGCCTTTCGATGTTGCAATACAACTCGAGTTGTATTGCAACATCGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-1402s1c1
Sequence:CCGGGCTAACTTCATAGACTGTGAACTCGAGTTCACAGTCTATGAAGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146114.1-880s1c1
Sequence:CCGGCCCTGTGGTATAACTTCCCAACTCGAGTTGGGAAGTTATACCACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-1879s1c1
Sequence:CCGGGCCTCTCAAATAGAACAGGATCTCGAGATCCTGTTCTATTTGAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146114.1-2233s1c1
Sequence:CCGGCAACAACAACAACAACAGAAACTCGAGTTTCTGTTGTTGTTGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-694s1c1
Sequence:CCGGGCTTATGGCTACGAGTATTTACTCGAGTAAATACTCGTAGCCATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146114.1-1169s1c1
Sequence:CCGGCAAAGTACAAACCGCTTGGAACTCGAGTTCCAAGCGGTTTGTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022487
VALIDATED
DCLRE1C MISSION shRNA Bacterial Glycerol Stock
DNA cross-link repair 1C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022487.1-2151s1c1
Sequence:CCGGGCACAGAGATGACAGTCAATACTCGAGTATTGACTGTCATCTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022487.1-842s1c1
Sequence:CCGGCTGTGGAATTACTTCCAGAAACTCGAGTTTCTGGAAGTAATTCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022487.1-1362s1c1
Sequence:CCGGCGTTTCACAAACTTTGTAGATCTCGAGATCTACAAAGTTTGTGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022487.1-1490s1c1
Sequence:CCGGCCAGTGGGAAGTATTCTTTAACTCGAGTTAAAGAATACTTCCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022487.1-1849s1c1
Sequence:CCGGGCAGAGATAAAGATGTGACAACTCGAGTTGTCACATCTTTATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1815s21c1
Sequence:CCGGATTTGCCCAAAGGATACTTACCTCGAGGTAAGTATCCTTTGGGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-650s21c1
Sequence:CCGGAGCGGCTTATGGCTATGAATACTCGAGTATTCATAGCCATAAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1070s21c1
Sequence:CCGGTATGGATAAAGTTGTCGAAATCTCGAGATTTCGACAACTTTATCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1212s21c1
Sequence:CCGGGATCCTCTGCCAATACCTTTACTCGAGTAAAGGTATTGGCAGAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-2018s21c1
Sequence:CCGGACGAGAGCATTTACAATATTTCTCGAGAAATATTGTAAATGCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022487
VALIDATED
DCLRE1C MISSION shRNA shRNA Plasmid DNA
DNA cross-link repair 1C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022487.1-2151s1c1
Sequence:CCGGGCACAGAGATGACAGTCAATACTCGAGTATTGACTGTCATCTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022487.1-842s1c1
Sequence:CCGGCTGTGGAATTACTTCCAGAAACTCGAGTTTCTGGAAGTAATTCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022487.1-1362s1c1
Sequence:CCGGCGTTTCACAAACTTTGTAGATCTCGAGATCTACAAAGTTTGTGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022487.1-1490s1c1
Sequence:CCGGCCAGTGGGAAGTATTCTTTAACTCGAGTTAAAGAATACTTCCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022487.1-1849s1c1
Sequence:CCGGGCAGAGATAAAGATGTGACAACTCGAGTTGTCACATCTTTATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1815s21c1
Sequence:CCGGATTTGCCCAAAGGATACTTACCTCGAGGTAAGTATCCTTTGGGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-650s21c1
Sequence:CCGGAGCGGCTTATGGCTATGAATACTCGAGTATTCATAGCCATAAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1070s21c1
Sequence:CCGGTATGGATAAAGTTGTCGAAATCTCGAGATTTCGACAACTTTATCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1212s21c1
Sequence:CCGGGATCCTCTGCCAATACCTTTACTCGAGTAAAGGTATTGGCAGAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-2018s21c1
Sequence:CCGGACGAGAGCATTTACAATATTTCTCGAGAAATATTGTAAATGCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022487
VALIDATED
DCLRE1C MISSION shRNA Lentiviral Transduction Particles
DNA cross-link repair 1C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022487.1-2151s1c1
Sequence:CCGGGCACAGAGATGACAGTCAATACTCGAGTATTGACTGTCATCTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022487.1-842s1c1
Sequence:CCGGCTGTGGAATTACTTCCAGAAACTCGAGTTTCTGGAAGTAATTCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022487.1-1362s1c1
Sequence:CCGGCGTTTCACAAACTTTGTAGATCTCGAGATCTACAAAGTTTGTGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022487.1-1490s1c1
Sequence:CCGGCCAGTGGGAAGTATTCTTTAACTCGAGTTAAAGAATACTTCCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022487.1-1849s1c1
Sequence:CCGGGCAGAGATAAAGATGTGACAACTCGAGTTGTCACATCTTTATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1815s21c1
Sequence:CCGGATTTGCCCAAAGGATACTTACCTCGAGGTAAGTATCCTTTGGGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-650s21c1
Sequence:CCGGAGCGGCTTATGGCTATGAATACTCGAGTATTCATAGCCATAAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1070s21c1
Sequence:CCGGTATGGATAAAGTTGTCGAAATCTCGAGATTTCGACAACTTTATCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-1212s21c1
Sequence:CCGGGATCCTCTGCCAATACCTTTACTCGAGTAAAGGTATTGGCAGAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022487.2-2018s21c1
Sequence:CCGGACGAGAGCATTTACAATATTTCTCGAGAAATATTGTAAATGCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)