EMAIL THIS PAGE TO A FRIEND

DCN

decorin

Synonyms: CSCD DSPG2 PG40 PGII PGS2 SLRR1B
UniProtKB ID: P07585, Q9P0Z0, Q9P0Z1, Q9Y5N8, Q9Y5N9
Gene ID:
Human(1634) Summary: The protein encoded by this gene is a small cellular or pericellular matrix proteoglycan that is closely related in structure to biglycan protein. The encoded protein and biglycan are thought to be the result of a gene duplication. This protein is a component of connective tissue, binds to type I collagen fibrils, and plays a role in matrix assembly. It contains one attached glycosaminoglycan chain. This protein is capable of suppressing the growth of various tumor cell lines. There are multiple alternatively spliced transcript variants known for this gene. This gene is a candidate gene for Marfan syndrome. [provided by RefSeq, Jul 2008]
Mouse(13179) decorin
Rat(29139) decorin
Goat(100860944) decorin
sheep(443048) decorin
cow(280760) decorin
chicken(417892) decorin
dog(403904) decorin
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100539 Anti-DCN (ab1) antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, pig, canine, rabbit, rat, rabbit, human, mouse, horse
western blot pricing
SAB2100540 Anti-DCN (ab2) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, canine, human, rabbit, bovine, rabbit, sheep, pig, goat
western blot pricing
SAB2501273 Anti-DCN antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405700 Anti-DCN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
SAB2108109 Anti-DCN antibody produced in rabbit affinity isolated antibody rat, rabbit, horse, human, pig, bovine, canine, mouse, guinea pig
western blot pricing
HPA003315 Anti-DCN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA064736 Anti-DCN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
WH0001634M1 Monoclonal Anti-DCN antibody produced in mouse clone 3H4-1F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403724 Monoclonal Anti-DCN antibody produced in mouse clone 2B5-G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001920 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001920 siRNAs that have been validated in the lab human pricing
NM_133503 Rosetta Predictions human pricing
NM_133504 Rosetta Predictions human pricing
NM_133505 Rosetta Predictions human pricing
NM_133506 Rosetta Predictions human pricing
NM_133507 Rosetta Predictions human pricing
NM_024129 Rosetta Predictions rat pricing
NM_007833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001920 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191021 validated 1631
1 SASI_Hs01_00191017 validated 1571
2 SASI_Hs01_00191023 predicted 1694
3 SASI_Hs02_00332805 predicted 1703
4 SASI_Hs02_00332806 predicted 1719
5 SASI_Hs01_00191016 predicted 1709
6 SASI_Hs01_00191019 predicted 1717
7 SASI_Hs01_00191020 predicted 1636
8 SASI_Hs02_00332807 predicted 1599
9 SASI_Hs02_00332808 predicted 1756
10 SASI_Hs01_00191018 predicted 1567
11 SASI_Hs01_00191022 predicted 1711
12 SASI_Hs01_00191024 predicted 1616
13 SASI_Hs01_00191025 predicted 1715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115073 predicted 1536
2 SASI_Hs02_00363233 predicted 1546
3 SASI_Hs02_00363234 predicted 1571
4 SASI_Hs01_00115066 predicted 1557
5 SASI_Hs01_00115067 predicted 1415
6 SASI_Hs01_00115069 predicted 1558
7 SASI_Hs01_00115070 predicted 1483
8 SASI_Hs01_00115071 predicted 1482
9 SASI_Hs02_00363235 predicted 1447
10 SASI_Hs02_00363236 predicted 1601
11 SASI_Hs01_00115068 predicted 1414
12 SASI_Hs01_00115072 predicted 1551
13 SASI_Hs01_00115074 predicted 1466
14 SASI_Hs01_00115075 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098099 predicted 959
2 SASI_Hs02_00363237 predicted 962
3 SASI_Hs02_00363238 predicted 985
4 SASI_Hs01_00098092 predicted 972
5 SASI_Hs01_00098093 predicted 828
6 SASI_Hs01_00098095 predicted 984
7 SASI_Hs01_00098096 predicted 894
8 SASI_Hs01_00098097 predicted 903
9 SASI_Hs02_00363239 predicted 860
10 SASI_Hs02_00363240 predicted 1016
11 SASI_Hs01_00098094 predicted 826
12 SASI_Hs01_00098098 predicted 968
13 SASI_Hs01_00098100 predicted 883
14 SASI_Hs01_00098101 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018772 predicted 843
2 SASI_Hs02_00363241 predicted 851
3 SASI_Hs02_00363242 predicted 870
4 SASI_Hs01_00018765 predicted 859
5 SASI_Hs01_00018766 predicted 714
6 SASI_Hs01_00018768 predicted 868
7 SASI_Hs01_00018769 predicted 785
8 SASI_Hs01_00018770 predicted 781
9 SASI_Hs02_00363243 predicted 745
10 SASI_Hs02_00363244 predicted 909
11 SASI_Hs01_00018767 predicted 713
12 SASI_Hs01_00018771 predicted 858
13 SASI_Hs01_00018773 predicted 770
14 SASI_Hs01_00018774 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148902 predicted 721
2 SASI_Hs02_00363245 predicted 734
3 SASI_Hs02_00363246 predicted 756
4 SASI_Hs01_00148895 predicted 739
5 SASI_Hs01_00148896 predicted 599
6 SASI_Hs01_00148898 predicted 742
7 SASI_Hs01_00148899 predicted 666
8 SASI_Hs01_00148900 predicted 663
9 SASI_Hs02_00363247 predicted 629
10 SASI_Hs02_00363248 predicted 784
11 SASI_Hs01_00148897 predicted 599
12 SASI_Hs01_00148901 predicted 741
13 SASI_Hs01_00148903 predicted 647
14 SASI_Hs01_00148904 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164991 predicted 603
2 SASI_Hs02_00363249 predicted 622
3 SASI_Hs02_00363250 predicted 637
4 SASI_Hs01_00164984 predicted 625
5 SASI_Hs01_00164985 predicted 481
6 SASI_Hs01_00164987 predicted 634
7 SASI_Hs01_00164988 predicted 548
8 SASI_Hs01_00164989 predicted 552
9 SASI_Hs02_00363251 predicted 510
10 SASI_Hs02_00363252 predicted 668
11 SASI_Hs01_00164986 predicted 489
12 SASI_Hs01_00164990 predicted 624
13 SASI_Hs01_00164992 predicted 542
14 SASI_Hs01_00164993 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106267 predicted 620
2 SASI_Rn01_00106268 predicted 792
3 SASI_Rn01_00106269 predicted 403
4 SASI_Rn01_00106270 predicted 447
5 SASI_Rn01_00106271 predicted 749
6 SASI_Rn01_00106272 predicted 782
7 SASI_Rn01_00106273 predicted 785
8 SASI_Rn01_00106274 predicted 543
9 SASI_Rn01_00106275 predicted 723
10 SASI_Rn01_00106276 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141230 predicted 267
2 SASI_Mm01_00141231 predicted 946
3 SASI_Mm01_00141232 predicted 315
4 SASI_Mm01_00141233 predicted 901
5 SASI_Mm01_00141235 predicted 915
6 SASI_Mm01_00141236 predicted 402
7 SASI_Mm01_00141237 predicted 587
8 SASI_Mm01_00141238 predicted 849
9 SASI_Mm02_00312570 predicted 800
10 SASI_Mm01_00141239 predicted 862
11 SASI_Mm01_00141234 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007833
VALIDATED
DCN MISSION shRNA Bacterial Glycerol Stock
decorin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-1190s21c1
Sequence:CCGGGTCCGGTATTGGGAAATCTTTCTCGAGAAAGATTTCCCAATACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-499s21c1
Sequence:CCGGCCTGAAGGACTTGCATACCTTCTCGAGAAGGTATGCAAGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-694s21c1
Sequence:CCGGCGACTTCAATGGACTGAACAACTCGAGTTGTTCAGTCCATTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-595s21c1
Sequence:CCGGCCTGTCTAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-909s21c1
Sequence:CCGGGCCTGAAAGGACTGATTAATTCTCGAGAATTAATCAGTCCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-621s1c1
Sequence:CCGGCCTGTCTAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-720s1c1
Sequence:CCGGCGACTTCAATGGACTGAACAACTCGAGTTGTTCAGTCCATTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-935s1c1
Sequence:CCGGGCCTGAAAGGACTGATTAATTCTCGAGAATTAATCAGTCCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-525s1c1
Sequence:CCGGCCTGAAGGACTTGCATACCTTCTCGAGAAGGTATGCAAGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-1216s1c1
Sequence:CCGGGTCCGGTATTGGGAAATCTTTCTCGAGAAAGATTTCCCAATACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007833
VALIDATED
DCN MISSION shRNA shRNA Plasmid DNA
decorin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-1190s21c1
Sequence:CCGGGTCCGGTATTGGGAAATCTTTCTCGAGAAAGATTTCCCAATACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-499s21c1
Sequence:CCGGCCTGAAGGACTTGCATACCTTCTCGAGAAGGTATGCAAGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-694s21c1
Sequence:CCGGCGACTTCAATGGACTGAACAACTCGAGTTGTTCAGTCCATTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-595s21c1
Sequence:CCGGCCTGTCTAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-909s21c1
Sequence:CCGGGCCTGAAAGGACTGATTAATTCTCGAGAATTAATCAGTCCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-621s1c1
Sequence:CCGGCCTGTCTAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-720s1c1
Sequence:CCGGCGACTTCAATGGACTGAACAACTCGAGTTGTTCAGTCCATTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-935s1c1
Sequence:CCGGGCCTGAAAGGACTGATTAATTCTCGAGAATTAATCAGTCCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-525s1c1
Sequence:CCGGCCTGAAGGACTTGCATACCTTCTCGAGAAGGTATGCAAGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-1216s1c1
Sequence:CCGGGTCCGGTATTGGGAAATCTTTCTCGAGAAAGATTTCCCAATACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007833
VALIDATED
DCN MISSION shRNA Lentiviral Transduction Particles
decorin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-1190s21c1
Sequence:CCGGGTCCGGTATTGGGAAATCTTTCTCGAGAAAGATTTCCCAATACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-499s21c1
Sequence:CCGGCCTGAAGGACTTGCATACCTTCTCGAGAAGGTATGCAAGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-694s21c1
Sequence:CCGGCGACTTCAATGGACTGAACAACTCGAGTTGTTCAGTCCATTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-595s21c1
Sequence:CCGGCCTGTCTAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007833.4-909s21c1
Sequence:CCGGGCCTGAAAGGACTGATTAATTCTCGAGAATTAATCAGTCCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-621s1c1
Sequence:CCGGCCTGTCTAAGAACCAACTAAACTCGAGTTTAGTTGGTTCTTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-720s1c1
Sequence:CCGGCGACTTCAATGGACTGAACAACTCGAGTTGTTCAGTCCATTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-935s1c1
Sequence:CCGGGCCTGAAAGGACTGATTAATTCTCGAGAATTAATCAGTCCTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-525s1c1
Sequence:CCGGCCTGAAGGACTTGCATACCTTCTCGAGAAGGTATGCAAGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007833.1-1216s1c1
Sequence:CCGGGTCCGGTATTGGGAAATCTTTCTCGAGAAAGATTTCCCAATACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001920
VALIDATED
DCN MISSION shRNA Bacterial Glycerol Stock
decorin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-792s21c1
Sequence:CCGGGGTGAAGTTGGAACGACTTTACTCGAGTAAAGTCGTTCCAACTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001920.3-1595s21c1
Sequence:CCGGTTTACCCACATGACTTATTATCTCGAGATAATAAGTCATGTGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-1470s21c1
Sequence:CCGGACTCGGAAACTATAAGTAATTCTCGAGAATTACTTATAGTTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-1023s21c1
Sequence:CCGGCCGCATTGCTGATACCAATATCTCGAGATATTGGTATCAGCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1925s1c1
Sequence:CCGGGCCTCATTTGAATGTGTGAATCTCGAGATTCACACATTCAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-805s1c1
Sequence:CCGGCGACTTTATCTGTCCAAGAATCTCGAGATTCTTGGACAGATAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1462s1c1
Sequence:CCGGGCCATTCAACTCGGAAACTATCTCGAGATAGTTTCCGAGTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1290s1c1
Sequence:CCGGCCAGGTTGTCTACCTTCATAACTCGAGTTATGAAGGTAGACAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-460s1c1
Sequence:CCGGCCGTTTCAACAGAGAGGCTTACTCGAGTAAGCCTCTCTGTTGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001920
VALIDATED
DCN MISSION shRNA shRNA Plasmid DNA
decorin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-792s21c1
Sequence:CCGGGGTGAAGTTGGAACGACTTTACTCGAGTAAAGTCGTTCCAACTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001920.3-1595s21c1
Sequence:CCGGTTTACCCACATGACTTATTATCTCGAGATAATAAGTCATGTGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-1470s21c1
Sequence:CCGGACTCGGAAACTATAAGTAATTCTCGAGAATTACTTATAGTTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-1023s21c1
Sequence:CCGGCCGCATTGCTGATACCAATATCTCGAGATATTGGTATCAGCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1925s1c1
Sequence:CCGGGCCTCATTTGAATGTGTGAATCTCGAGATTCACACATTCAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-805s1c1
Sequence:CCGGCGACTTTATCTGTCCAAGAATCTCGAGATTCTTGGACAGATAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1462s1c1
Sequence:CCGGGCCATTCAACTCGGAAACTATCTCGAGATAGTTTCCGAGTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1290s1c1
Sequence:CCGGCCAGGTTGTCTACCTTCATAACTCGAGTTATGAAGGTAGACAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-460s1c1
Sequence:CCGGCCGTTTCAACAGAGAGGCTTACTCGAGTAAGCCTCTCTGTTGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001920
VALIDATED
DCN MISSION shRNA Lentiviral Transduction Particles
decorin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-792s21c1
Sequence:CCGGGGTGAAGTTGGAACGACTTTACTCGAGTAAAGTCGTTCCAACTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001920.3-1595s21c1
Sequence:CCGGTTTACCCACATGACTTATTATCTCGAGATAATAAGTCATGTGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-1470s21c1
Sequence:CCGGACTCGGAAACTATAAGTAATTCTCGAGAATTACTTATAGTTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001920.3-1023s21c1
Sequence:CCGGCCGCATTGCTGATACCAATATCTCGAGATATTGGTATCAGCAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1925s1c1
Sequence:CCGGGCCTCATTTGAATGTGTGAATCTCGAGATTCACACATTCAAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-805s1c1
Sequence:CCGGCGACTTTATCTGTCCAAGAATCTCGAGATTCTTGGACAGATAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1462s1c1
Sequence:CCGGGCCATTCAACTCGGAAACTATCTCGAGATAGTTTCCGAGTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-1290s1c1
Sequence:CCGGCCAGGTTGTCTACCTTCATAACTCGAGTTATGAAGGTAGACAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001920.3-460s1c1
Sequence:CCGGCCGTTTCAACAGAGAGGCTTACTCGAGTAAGCCTCTCTGTTGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks