EMAIL THIS PAGE TO A FRIEND

DCP1A

decapping mRNA 1A

72 Gene Product Result for
Synonyms: HSA275986 Nbla00360 SMAD4IP1 SMIF
UniProtKB ID: Q9NPI6
Gene ID:
Human(55802) Summary: Decapping is a key step in general and regulated mRNA decay. The protein encoded by this gene is a decapping enzyme. This protein and another decapping enzyme form a decapping complex, which interacts with the nonsense-mediated decay factor hUpf1 and may be recruited to mRNAs containing premature termination codons. This protein also participates in the TGF-beta signaling pathway. [provided by RefSeq, Jul 2008]
Mouse(75901) DCP1 decapping enzyme homolog A (S. cerevisiae)
Rat(361109) DCP1 decapping enzyme homolog A (S. cerevisiae)
Zebrafish(360153) DCP1 decapping enzyme homolog A (S. cerevisiae)
dog(607346) DCP1 decapping enzyme homolog A (S. cerevisiae)
domestic cat(101087975) DCP1 decapping enzyme homolog A (S. cerevisiae)
cow(783258) DCP1 decapping enzyme homolog A (S. cerevisiae)
Horse(100051259) DCP1 decapping enzyme homolog A (S. cerevisiae)
chicken(415992) DCP1 decapping enzyme homolog A (S. cerevisiae)
sheep(101106973) DCP1 decapping enzyme homolog A (S. cerevisiae)
Domestic Rabbit(100349581) DCP1 decapping enzyme homolog A (S. cerevisiae)
naked mole-rat(101714261) decapping mRNA 1A
domestic guinea pig(100725542) decapping mRNA 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34582 Anti-DCP1A (AB1) antibody produced in rabbit IgG fraction of antiserum rabbit, mouse, canine, guinea pig, human, horse, bovine, rat
western blot pricing
AV39353 Anti-DCP1A (AB2) antibody produced in rabbit IgG fraction of antiserum rat, human, guinea pig, horse, bovine, canine, rabbit, zebrafish, mouse
western blot pricing
D5444 Anti-DCP1A (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat (predicted)
immunofluorescence, immunoprecipitation, western blot pricing
D5694 Anti-DCP1A (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunofluorescence, immunoprecipitation, western blot pricing
SAB2500300 Anti-DCP1A antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1407698 Anti-DCP1A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
HPA013202 Anti-DCP1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4502364 Anti-DCP1A antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
WH0055802M6 Monoclonal Anti-DCP1A antibody produced in mouse clone 3G4, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB1405162 Monoclonal Anti-DCP1A antibody produced in mouse clone 2D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018403 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018403 Rosetta Predictions human pricing
XM_001063126 Rosetta Predictions rat pricing
XM_341395 Rosetta Predictions rat pricing
NM_133761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212831 predicted 1109
2 SASI_Hs01_00212832 predicted 704
3 SASI_Hs02_00351899 predicted 736
4 SASI_Hs01_00212835 predicted 859
5 SASI_Hs02_00351900 predicted 1492
6 SASI_Hs01_00212836 predicted 376
7 SASI_Hs01_00212837 predicted 837
8 SASI_Hs01_00212838 predicted 426
9 SASI_Hs01_00212839 predicted 598
10 SASI_Hs02_00351901 predicted 229
11 SASI_Hs01_00212830 predicted 306
12 SASI_Hs01_00212833 predicted 348
13 SASI_Hs01_00212834 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305920 predicted 301
2 SASI_Rn02_00305921 predicted 342
3 SASI_Rn02_00305922 predicted 421
4 SASI_Rn02_00305923 predicted 1111
5 SASI_Rn02_00305924 predicted 1118
6 SASI_Rn02_00305925 predicted 450
7 SASI_Rn02_00305926 predicted 406
8 SASI_Rn02_00305927 predicted 254
9 SASI_Rn02_00305928 predicted 354
10 SASI_Rn02_00305929 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392848 predicted 303
2 SASI_Rn02_00392849 predicted 344
3 SASI_Rn02_00392850 predicted 421
4 SASI_Rn02_00392851 predicted 1108
5 SASI_Rn02_00392852 predicted 1118
6 SASI_Rn02_00392853 predicted 446
7 SASI_Rn02_00392854 predicted 408
8 SASI_Rn02_00392855 predicted 257
9 SASI_Rn02_00392856 predicted 358
10 SASI_Rn02_00392857 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102317 predicted 439
2 SASI_Mm01_00102318 predicted 446
3 SASI_Mm02_00338757 predicted 762
4 SASI_Mm01_00102319 predicted 387
5 SASI_Mm02_00338758 predicted 1277
6 SASI_Mm01_00102320 predicted 1123
7 SASI_Mm01_00102321 predicted 417
8 SASI_Mm01_00102322 predicted 1109
9 SASI_Mm01_00102323 predicted 726
10 SASI_Mm01_00102325 predicted 1816
11 SASI_Mm01_00102324 predicted 307
12 SASI_Mm01_00102326 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018403
VALIDATED
DCP1A MISSION shRNA Bacterial Glycerol Stock
decapping mRNA 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018403.2-283s1c1
Sequence:CCGGCGACTAAATATGCACAATCTACTCGAGTAGATTGTGCATATTTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018403.2-1475s1c1
Sequence:CCGGCTGAAGTATTTGTGCAGCCTACTCGAGTAGGCTGCACAAATACTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018403.2-844s1c1
Sequence:CCGGCCATTTCCCTTTGAGCAGTTACTCGAGTAACTGCTCAAAGGGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018403.2-272s1c1
Sequence:CCGGCCATTGTGAATCGACTAAATACTCGAGTATTTAGTCGATTCACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018403.2-722s1c1
Sequence:CCGGCGGTAGAAGAGTTATTTGGAACTCGAGTTCCAAATAACTCTTCTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018403.4-237s21c1
Sequence:CCGGTGATATAGAAGGGACCTTATTCTCGAGAATAAGGTCCCTTCTATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-1508s21c1
Sequence:CCGGTTGTGCAGCCTAAGGTGTTATCTCGAGATAACACCTTAGGCTGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-389s21c1
Sequence:CCGGATGCAAGCTTGTCGATATATACTCGAGTATATATCGACAAGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-3722s21c1
Sequence:CCGGGGGATTCTTGAATCGAAATTACTCGAGTAATTTCGATTCAAGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-295s21c1
Sequence:CCGGACCATTGTGAATCGACTAAATCTCGAGATTTAGTCGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018403
VALIDATED
DCP1A MISSION shRNA shRNA Plasmid DNA
decapping mRNA 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018403.2-283s1c1
Sequence:CCGGCGACTAAATATGCACAATCTACTCGAGTAGATTGTGCATATTTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018403.2-1475s1c1
Sequence:CCGGCTGAAGTATTTGTGCAGCCTACTCGAGTAGGCTGCACAAATACTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018403.2-844s1c1
Sequence:CCGGCCATTTCCCTTTGAGCAGTTACTCGAGTAACTGCTCAAAGGGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018403.2-272s1c1
Sequence:CCGGCCATTGTGAATCGACTAAATACTCGAGTATTTAGTCGATTCACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018403.2-722s1c1
Sequence:CCGGCGGTAGAAGAGTTATTTGGAACTCGAGTTCCAAATAACTCTTCTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018403.4-237s21c1
Sequence:CCGGTGATATAGAAGGGACCTTATTCTCGAGAATAAGGTCCCTTCTATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-1508s21c1
Sequence:CCGGTTGTGCAGCCTAAGGTGTTATCTCGAGATAACACCTTAGGCTGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-389s21c1
Sequence:CCGGATGCAAGCTTGTCGATATATACTCGAGTATATATCGACAAGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-3722s21c1
Sequence:CCGGGGGATTCTTGAATCGAAATTACTCGAGTAATTTCGATTCAAGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-295s21c1
Sequence:CCGGACCATTGTGAATCGACTAAATCTCGAGATTTAGTCGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018403
VALIDATED
DCP1A MISSION shRNA Lentiviral Transduction Particles
decapping mRNA 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018403.2-283s1c1
Sequence:CCGGCGACTAAATATGCACAATCTACTCGAGTAGATTGTGCATATTTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018403.2-1475s1c1
Sequence:CCGGCTGAAGTATTTGTGCAGCCTACTCGAGTAGGCTGCACAAATACTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018403.2-844s1c1
Sequence:CCGGCCATTTCCCTTTGAGCAGTTACTCGAGTAACTGCTCAAAGGGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018403.2-272s1c1
Sequence:CCGGCCATTGTGAATCGACTAAATACTCGAGTATTTAGTCGATTCACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018403.2-722s1c1
Sequence:CCGGCGGTAGAAGAGTTATTTGGAACTCGAGTTCCAAATAACTCTTCTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018403.4-237s21c1
Sequence:CCGGTGATATAGAAGGGACCTTATTCTCGAGAATAAGGTCCCTTCTATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-1508s21c1
Sequence:CCGGTTGTGCAGCCTAAGGTGTTATCTCGAGATAACACCTTAGGCTGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-389s21c1
Sequence:CCGGATGCAAGCTTGTCGATATATACTCGAGTATATATCGACAAGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-3722s21c1
Sequence:CCGGGGGATTCTTGAATCGAAATTACTCGAGTAATTTCGATTCAAGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018403.4-295s21c1
Sequence:CCGGACCATTGTGAATCGACTAAATCTCGAGATTTAGTCGATTCACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133761
VALIDATED
DCP1A MISSION shRNA Bacterial Glycerol Stock
decapping mRNA 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133761.2-2583s1c1
Sequence:CCGGGCCCTGTTCAAGAATCCAGAACTCGAGTTCTGGATTCTTGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1073s1c1
Sequence:CCGGCCTCGGAATAGCACCATGATACTCGAGTATCATGGTGCTATTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133761.2-623s1c1
Sequence:CCGGCCAAGCACTCAGCTCTCTAATCTCGAGATTAGAGAGCTGAGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1780s1c1
Sequence:CCGGGCAGGTTCTGACCAAGAACAACTCGAGTTGTTCTTGGTCAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1365s1c1
Sequence:CCGGGCTTCATAGAACCTTCTTCTACTCGAGTAGAAGAAGGTTCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133761
VALIDATED
DCP1A MISSION shRNA shRNA Plasmid DNA
decapping mRNA 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133761.2-2583s1c1
Sequence:CCGGGCCCTGTTCAAGAATCCAGAACTCGAGTTCTGGATTCTTGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1073s1c1
Sequence:CCGGCCTCGGAATAGCACCATGATACTCGAGTATCATGGTGCTATTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133761.2-623s1c1
Sequence:CCGGCCAAGCACTCAGCTCTCTAATCTCGAGATTAGAGAGCTGAGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1780s1c1
Sequence:CCGGGCAGGTTCTGACCAAGAACAACTCGAGTTGTTCTTGGTCAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1365s1c1
Sequence:CCGGGCTTCATAGAACCTTCTTCTACTCGAGTAGAAGAAGGTTCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133761
VALIDATED
DCP1A MISSION shRNA Lentiviral Transduction Particles
decapping mRNA 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096664    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133761.2-2583s1c1
Sequence:CCGGGCCCTGTTCAAGAATCCAGAACTCGAGTTCTGGATTCTTGAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1073s1c1
Sequence:CCGGCCTCGGAATAGCACCATGATACTCGAGTATCATGGTGCTATTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133761.2-623s1c1
Sequence:CCGGCCAAGCACTCAGCTCTCTAATCTCGAGATTAGAGAGCTGAGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1780s1c1
Sequence:CCGGGCAGGTTCTGACCAAGAACAACTCGAGTTGTTCTTGGTCAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133761.2-1365s1c1
Sequence:CCGGGCTTCATAGAACCTTCTTCTACTCGAGTAGAAGAAGGTTCTATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks