EMAIL THIS PAGE TO A FRIEND

DCP1B

decapping mRNA 1B

60 Gene Product Result for
Synonyms: DCP1 hDcp1b
UniProtKB ID: Q8IZD4, Q86XH9, Q96BP8, Q96MZ8
Gene ID:
Human(196513) Summary: DCP1B is a core component of the mRNA decapping complex, a key factor in the regulation of mRNA decay (Lykke-Andersen, 2002 [PubMed 12417715]
Mouse(319618) DCP1 decapping enzyme homolog B (S. cerevisiae)
Rat(500305) decapping mRNA 1B
domestic guinea pig(101789290) decapping mRNA 1B
naked mole-rat(101716540) decapping mRNA 1B
sheep(101121671) DCP1 decapping enzyme homolog B (S. cerevisiae)
Zebrafish(568176) DCP1 decapping enzyme homolog B (S. cerevisiae)
cow(514548) DCP1 decapping enzyme homolog B (S. cerevisiae)
domestic cat(101085048) DCP1 decapping enzyme homolog B (S. cerevisiae)
dog(477734) DCP1 decapping enzyme homolog B (S. cerevisiae)
chicken(772197) DCP1 decapping enzyme homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152640 Rosetta Predictions human pricing
XM_001057512 Rosetta Predictions rat pricing
XM_575654 Rosetta Predictions rat pricing
NM_001033379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229589 predicted 1570
2 SASI_Hs01_00229590 predicted 391
3 SASI_Hs01_00229591 predicted 587
4 SASI_Hs01_00229592 predicted 1173
5 SASI_Hs02_00366527 predicted 430
6 SASI_Hs01_00229593 predicted 278
7 SASI_Hs01_00229594 predicted 399
8 SASI_Hs01_00229595 predicted 1317
9 SASI_Hs01_00229597 predicted 466
10 SASI_Hs01_00229598 predicted 1433
11 SASI_Hs01_00229596 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286656 predicted 617
2 SASI_Rn02_00286657 predicted 550
3 SASI_Rn02_00286658 predicted 506
4 SASI_Rn02_00286659 predicted 676
5 SASI_Rn02_00286660 predicted 922
6 SASI_Rn02_00286661 predicted 622
7 SASI_Rn02_00286662 predicted 950
8 SASI_Rn02_00286663 predicted 774
9 SASI_Rn02_00286664 predicted 859
10 SASI_Rn02_00286665 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403988 predicted 626
2 SASI_Rn02_00403989 predicted 547
3 SASI_Rn02_00403990 predicted 511
4 SASI_Rn02_00403991 predicted 667
5 SASI_Rn02_00403992 predicted 921
6 SASI_Rn02_00403993 predicted 624
7 SASI_Rn02_00403994 predicted 947
8 SASI_Rn02_00403995 predicted 772
9 SASI_Rn02_00403996 predicted 853
10 SASI_Rn02_00403997 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142179 predicted 1088
2 SASI_Mm01_00142180 predicted 286
3 SASI_Mm01_00142181 predicted 1561
4 SASI_Mm01_00142183 predicted 249
5 SASI_Mm01_00142184 predicted 1507
6 SASI_Mm01_00142185 predicted 539
7 SASI_Mm01_00142186 predicted 236
8 SASI_Mm01_00142187 predicted 1678
9 SASI_Mm01_00142188 predicted 1041
10 SASI_Mm02_00288685 predicted 1528
11 SASI_Mm01_00142182 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152640
VALIDATED
DCP1B MISSION shRNA Bacterial Glycerol Stock
decapping mRNA 1B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-1038s21c1
Sequence:CCGGAGTACCCATTCTGCGGGAGAACTCGAGTTCTCCCGCAGAATGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-397s21c1
Sequence:CCGGGATTGTCCATCTATGGAATTTCTCGAGAAATTCCATAGATGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-283s21c1
Sequence:CCGGCAAAGCATGGATTCACCATTACTCGAGTAATGGTGAATCCATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-757s21c1
Sequence:CCGGTATCCTTGACAGCTCTGTTTGCTCGAGCAAACAGAGCTGTCAAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-339s21c1
Sequence:CCGGATTACTAAAGACTTGGATTTCCTCGAGGAAATCCAAGTCTTTAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-1875s21c1
Sequence:CCGGATAATCTATGAAGCCTATCTCCTCGAGGAGATAGGCTTCATAGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-645s1c1
Sequence:CCGGGCCATCTATGACAATCCAAATCTCGAGATTTGGATTGTCATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-372s1c1
Sequence:CCGGCCTTTCCTTCTCTACAGAAATCTCGAGATTTCTGTAGAGAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-467s1c1
Sequence:CCGGCCTAACTCAGTATGAACAGTTCTCGAGAACTGTTCATACTGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-1844s1c1
Sequence:CCGGCCTCATTCAGAATGATGACAACTCGAGTTGTCATCATTCTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-588s1c1
Sequence:CCGGGACGAATACACAAAGTGTAAACTCGAGTTTACACTTTGTGTATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152640
VALIDATED
DCP1B MISSION shRNA shRNA Plasmid DNA
decapping mRNA 1B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-1038s21c1
Sequence:CCGGAGTACCCATTCTGCGGGAGAACTCGAGTTCTCCCGCAGAATGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-397s21c1
Sequence:CCGGGATTGTCCATCTATGGAATTTCTCGAGAAATTCCATAGATGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-283s21c1
Sequence:CCGGCAAAGCATGGATTCACCATTACTCGAGTAATGGTGAATCCATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-757s21c1
Sequence:CCGGTATCCTTGACAGCTCTGTTTGCTCGAGCAAACAGAGCTGTCAAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-339s21c1
Sequence:CCGGATTACTAAAGACTTGGATTTCCTCGAGGAAATCCAAGTCTTTAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-1875s21c1
Sequence:CCGGATAATCTATGAAGCCTATCTCCTCGAGGAGATAGGCTTCATAGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-645s1c1
Sequence:CCGGGCCATCTATGACAATCCAAATCTCGAGATTTGGATTGTCATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-372s1c1
Sequence:CCGGCCTTTCCTTCTCTACAGAAATCTCGAGATTTCTGTAGAGAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-467s1c1
Sequence:CCGGCCTAACTCAGTATGAACAGTTCTCGAGAACTGTTCATACTGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-1844s1c1
Sequence:CCGGCCTCATTCAGAATGATGACAACTCGAGTTGTCATCATTCTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-588s1c1
Sequence:CCGGGACGAATACACAAAGTGTAAACTCGAGTTTACACTTTGTGTATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152640
VALIDATED
DCP1B MISSION shRNA Lentiviral Transduction Particles
decapping mRNA 1B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-1038s21c1
Sequence:CCGGAGTACCCATTCTGCGGGAGAACTCGAGTTCTCCCGCAGAATGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-397s21c1
Sequence:CCGGGATTGTCCATCTATGGAATTTCTCGAGAAATTCCATAGATGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-283s21c1
Sequence:CCGGCAAAGCATGGATTCACCATTACTCGAGTAATGGTGAATCCATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-757s21c1
Sequence:CCGGTATCCTTGACAGCTCTGTTTGCTCGAGCAAACAGAGCTGTCAAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-339s21c1
Sequence:CCGGATTACTAAAGACTTGGATTTCCTCGAGGAAATCCAAGTCTTTAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152640.3-1875s21c1
Sequence:CCGGATAATCTATGAAGCCTATCTCCTCGAGGAGATAGGCTTCATAGATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-645s1c1
Sequence:CCGGGCCATCTATGACAATCCAAATCTCGAGATTTGGATTGTCATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-372s1c1
Sequence:CCGGCCTTTCCTTCTCTACAGAAATCTCGAGATTTCTGTAGAGAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-467s1c1
Sequence:CCGGCCTAACTCAGTATGAACAGTTCTCGAGAACTGTTCATACTGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-1844s1c1
Sequence:CCGGCCTCATTCAGAATGATGACAACTCGAGTTGTCATCATTCTGAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_152640.3-588s1c1
Sequence:CCGGGACGAATACACAAAGTGTAAACTCGAGTTTACACTTTGTGTATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033379
DCP1B MISSION shRNA Bacterial Glycerol Stock
decapping mRNA 1B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-287s21c1
Sequence:GTACCGGAGAACAGAACCCATTACTAAACTCGAGTTTAGTAATGGGTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-1206s21c1
Sequence:CCGGCCCAATCACAGCTGGTGTATTCTCGAGAATACACCAGCTGTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-711s21c1
Sequence:CCGGTATCTTTAACAGCACTATTTGCTCGAGCAAATAGTGCTGTTAAAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-351s21c1
Sequence:CCGGACGGCACACTGTCCATTTATGCTCGAGCATAAATGGACAGTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-1710s21c1
Sequence:CCGGACTTCTTAAGCATAATCTATGCTCGAGCATAGATTATGCTTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033379.3-2074s21c1
Sequence:CCGGGGAGGTTCTCAGAGCTATTTACTCGAGTAAATAGCTCTGAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033379.3-2002s21c1
Sequence:CCGGAGGTCATGTAAGGTTCGATTTCTCGAGAAATCGAACCTTACATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033379
DCP1B MISSION shRNA shRNA Plasmid DNA
decapping mRNA 1B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-287s21c1
Sequence:GTACCGGAGAACAGAACCCATTACTAAACTCGAGTTTAGTAATGGGTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-1206s21c1
Sequence:CCGGCCCAATCACAGCTGGTGTATTCTCGAGAATACACCAGCTGTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-711s21c1
Sequence:CCGGTATCTTTAACAGCACTATTTGCTCGAGCAAATAGTGCTGTTAAAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-351s21c1
Sequence:CCGGACGGCACACTGTCCATTTATGCTCGAGCATAAATGGACAGTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-1710s21c1
Sequence:CCGGACTTCTTAAGCATAATCTATGCTCGAGCATAGATTATGCTTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033379.3-2074s21c1
Sequence:CCGGGGAGGTTCTCAGAGCTATTTACTCGAGTAAATAGCTCTGAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033379.3-2002s21c1
Sequence:CCGGAGGTCATGTAAGGTTCGATTTCTCGAGAAATCGAACCTTACATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033379
DCP1B MISSION shRNA Lentiviral Transduction Particles
decapping mRNA 1B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-287s21c1
Sequence:GTACCGGAGAACAGAACCCATTACTAAACTCGAGTTTAGTAATGGGTTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-1206s21c1
Sequence:CCGGCCCAATCACAGCTGGTGTATTCTCGAGAATACACCAGCTGTGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-711s21c1
Sequence:CCGGTATCTTTAACAGCACTATTTGCTCGAGCAAATAGTGCTGTTAAAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-351s21c1
Sequence:CCGGACGGCACACTGTCCATTTATGCTCGAGCATAAATGGACAGTGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033379.2-1710s21c1
Sequence:CCGGACTTCTTAAGCATAATCTATGCTCGAGCATAGATTATGCTTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033379.3-2074s21c1
Sequence:CCGGGGAGGTTCTCAGAGCTATTTACTCGAGTAAATAGCTCTGAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033379.3-2002s21c1
Sequence:CCGGAGGTCATGTAAGGTTCGATTTCTCGAGAAATCGAACCTTACATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks