EMAIL THIS PAGE TO A FRIEND

DCP2

decapping mRNA 2

224 Gene Product Result for
Synonyms: NUDT20
UniProtKB ID: Q8IU60, C9J778, Q6P2D4, Q7Z5W5, Q8NBG5
Gene ID:
Human(167227) Summary: The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
Mouse(70640) DCP2 decapping enzyme homolog (S. cerevisiae)
Rat(291604) decapping mRNA 2
Zebrafish(393121) DCP2 decapping enzyme homolog (S. cerevisiae)
cow(539770) DCP2 decapping enzyme homolog (S. cerevisiae)
Horse(100073182) DCP2 decapping enzyme homolog (S. cerevisiae)
domestic cat(101097375) DCP2 decapping enzyme homolog (S. cerevisiae)
dog(489086) DCP2 decapping enzyme homolog (S. cerevisiae)
chicken(769972) DCP2 decapping enzyme homolog (S. cerevisiae)
Thale Cress(831201) mRNA-decapping enzyme subunit 2
fruit fly(39722) Decapping protein 2
sheep(101103649) DCP2 decapping enzyme homolog (S. cerevisiae)
naked mole-rat(101697533) decapping mRNA 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D6319 Anti-DCP2 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunofluorescence, western blot pricing
D6194 Anti-DCP2 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse (predicted), human, rat (predicted)
immunofluorescence, western blot pricing
SAB1408413 Anti-DCP2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2702504 Anti-Dcp2 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB2107988 Anti-DCP2 antibody produced in rabbit affinity isolated antibody canine, mouse, horse, guinea pig, rat, human
western blot pricing
AV41150 Anti-DCP2 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, mouse, rat, horse, human
western blot pricing
SAB2100542 Anti-DCP2 antibody produced in rabbit affinity isolated antibody canine, human, rat, mouse, horse, rabbit, guinea pig
western blot pricing
HPA057676 Anti-DCP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
PLA0262 Rabbit anti-Dcp2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. pig, primate, dog, rhesus monkey, gorilla, human, horse, marmoset, chimpanzee, bovine
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152624 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152624 Rosetta Predictions human pricing
XM_001055777 Rosetta Predictions rat pricing
XM_225963 Rosetta Predictions rat pricing
NM_027490 Rosetta Predictions mouse pricing
XM_140308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232657 predicted 390
2 SASI_Hs01_00232660 predicted 1321
3 SASI_Hs01_00232661 predicted 892
4 SASI_Hs01_00232662 predicted 361
5 SASI_Hs01_00232664 predicted 497
6 SASI_Hs01_00232665 predicted 281
7 SASI_Hs01_00232666 predicted 1027
8 SASI_Hs02_00366486 predicted 234
9 SASI_Hs02_00366487 predicted 1363
10 SASI_Hs02_00366488 predicted 1526
11 SASI_Hs01_00232658 predicted 890
12 SASI_Hs01_00232659 predicted 1099
13 SASI_Hs01_00232663 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280964 predicted 1423
2 SASI_Rn02_00280965 predicted 473
3 SASI_Rn02_00280966 predicted 1190
4 SASI_Rn02_00280967 predicted 510
5 SASI_Rn02_00280968 predicted 511
6 SASI_Rn02_00280969 predicted 1385
7 SASI_Rn02_00280970 predicted 1373
8 SASI_Rn02_00280971 predicted 300
9 SASI_Rn02_00280972 predicted 1289
10 SASI_Rn02_00280973 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383290 predicted 1425
2 SASI_Rn02_00383291 predicted 472
3 SASI_Rn02_00383292 predicted 1187
4 SASI_Rn02_00383293 predicted 505
5 SASI_Rn02_00383294 predicted 519
6 SASI_Rn02_00383295 predicted 1387
7 SASI_Rn02_00383296 predicted 1378
8 SASI_Rn02_00383297 predicted 304
9 SASI_Rn02_00383298 predicted 1285
10 SASI_Rn02_00383299 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332307 predicted 1104
2 SASI_Mm02_00332308 predicted 736
3 SASI_Mm02_00332309 predicted 1279
4 SASI_Mm02_00332310 predicted 703
5 SASI_Mm02_00332311 predicted 821
6 SASI_Mm02_00332312 predicted 388
7 SASI_Mm02_00332313 predicted 423
8 SASI_Mm02_00332314 predicted 307
9 SASI_Mm02_00332315 predicted 1390
10 SASI_Mm02_00332316 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266235 predicted 1160
2 SASI_Mm01_00266236 predicted 792
3 SASI_Mm01_00266237 predicted 371
4 SASI_Mm01_00266238 predicted 1329
5 SASI_Mm01_00266239 predicted 759
6 SASI_Mm01_00266240 predicted 870
7 SASI_Mm01_00266241 predicted 451
8 SASI_Mm01_00266242 predicted 476
9 SASI_Mm01_00266243 predicted 370
10 SASI_Mm01_00266244 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152624
VALIDATED
DCP2 MISSION shRNA Bacterial Glycerol Stock
decapping mRNA 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-1267s1c1
Sequence:CCGGCCACGGAAACTTCAGGATAATCTCGAGATTATCCTGAAGTTTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-881s1c1
Sequence:CCGGCCATTCCCTTTATCAGACCATCTCGAGATGGTCTGATAAAGGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-336s1c1
Sequence:CCGGCTTGGATTTCTACATGCAGAACTCGAGTTCTGCATGTAGAAATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-276s1c1
Sequence:CCGGCGAGGAAAGAGACAATGCAATCTCGAGATTGCATTGTCTCTTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-1361s1c1
Sequence:CCGGCCGTGGCATGTAATGGACATTCTCGAGAATGTCCATTACATGCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152624.4-1913s21c1
Sequence:CCGGAGCATTACAGGTGATCTATTTCTCGAGAAATAGATCACCTGTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-907s21c1
Sequence:CCGGGACTGGCTTTCTCGAAGATTTCTCGAGAAATCTTCGAGAAAGCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-336s21c1
Sequence:CCGGCTTGGATTTCTACATGCAGAACTCGAGTTCTGCATGTAGAAATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152624.4-1267s21c1
Sequence:CCGGCCACGGAAACTTCAGGATAATCTCGAGATTATCCTGAAGTTTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-239s21c1
Sequence:CCGGACGATCTCTGCAGCCGATTTACTCGAGTAAATCGGCTGCAGAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152624
VALIDATED
DCP2 MISSION shRNA shRNA Plasmid DNA
decapping mRNA 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-1267s1c1
Sequence:CCGGCCACGGAAACTTCAGGATAATCTCGAGATTATCCTGAAGTTTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-881s1c1
Sequence:CCGGCCATTCCCTTTATCAGACCATCTCGAGATGGTCTGATAAAGGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-336s1c1
Sequence:CCGGCTTGGATTTCTACATGCAGAACTCGAGTTCTGCATGTAGAAATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-276s1c1
Sequence:CCGGCGAGGAAAGAGACAATGCAATCTCGAGATTGCATTGTCTCTTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-1361s1c1
Sequence:CCGGCCGTGGCATGTAATGGACATTCTCGAGAATGTCCATTACATGCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152624.4-1913s21c1
Sequence:CCGGAGCATTACAGGTGATCTATTTCTCGAGAAATAGATCACCTGTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-907s21c1
Sequence:CCGGGACTGGCTTTCTCGAAGATTTCTCGAGAAATCTTCGAGAAAGCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-336s21c1
Sequence:CCGGCTTGGATTTCTACATGCAGAACTCGAGTTCTGCATGTAGAAATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152624.4-1267s21c1
Sequence:CCGGCCACGGAAACTTCAGGATAATCTCGAGATTATCCTGAAGTTTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-239s21c1
Sequence:CCGGACGATCTCTGCAGCCGATTTACTCGAGTAAATCGGCTGCAGAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152624
VALIDATED
DCP2 MISSION shRNA Lentiviral Transduction Particles
decapping mRNA 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-1267s1c1
Sequence:CCGGCCACGGAAACTTCAGGATAATCTCGAGATTATCCTGAAGTTTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-881s1c1
Sequence:CCGGCCATTCCCTTTATCAGACCATCTCGAGATGGTCTGATAAAGGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-336s1c1
Sequence:CCGGCTTGGATTTCTACATGCAGAACTCGAGTTCTGCATGTAGAAATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-276s1c1
Sequence:CCGGCGAGGAAAGAGACAATGCAATCTCGAGATTGCATTGTCTCTTTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152624.3-1361s1c1
Sequence:CCGGCCGTGGCATGTAATGGACATTCTCGAGAATGTCCATTACATGCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152624.4-1913s21c1
Sequence:CCGGAGCATTACAGGTGATCTATTTCTCGAGAAATAGATCACCTGTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-907s21c1
Sequence:CCGGGACTGGCTTTCTCGAAGATTTCTCGAGAAATCTTCGAGAAAGCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-336s21c1
Sequence:CCGGCTTGGATTTCTACATGCAGAACTCGAGTTCTGCATGTAGAAATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_152624.4-1267s21c1
Sequence:CCGGCCACGGAAACTTCAGGATAATCTCGAGATTATCCTGAAGTTTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152624.4-239s21c1
Sequence:CCGGACGATCTCTGCAGCCGATTTACTCGAGTAAATCGGCTGCAGAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027490
VALIDATED
DCP2 MISSION shRNA Bacterial Glycerol Stock
decapping mRNA 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027490.1-176s21c1
Sequence:CCGGTGATCTCTGCAGCCGATTTATCTCGAGATAAATCGGCTGCAGAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027490.1-785s21c1
Sequence:CCGGGCTTGGCTTGGCACCTAATAACTCGAGTTATTAGGTGCCAAGCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027490.1-843s21c1
Sequence:CCGGGACTGGCTGTCTCGAAGATTTCTCGAGAAATCTTCGAGACAGCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027490.1-3540s21c1
Sequence:CCGGTTAGCTGGGAGACCATATTTACTCGAGTAAATATGGTCTCCCAGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027490.1-427s21c1
Sequence:CCGGCGACTTACGGTGCAATTATTCCTCGAGGAATAATTGCACCGTAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027490
VALIDATED
DCP2 MISSION shRNA shRNA Plasmid DNA
decapping mRNA 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027490.1-176s21c1
Sequence:CCGGTGATCTCTGCAGCCGATTTATCTCGAGATAAATCGGCTGCAGAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027490.1-785s21c1
Sequence:CCGGGCTTGGCTTGGCACCTAATAACTCGAGTTATTAGGTGCCAAGCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027490.1-843s21c1
Sequence:CCGGGACTGGCTGTCTCGAAGATTTCTCGAGAAATCTTCGAGACAGCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027490.1-3540s21c1
Sequence:CCGGTTAGCTGGGAGACCATATTTACTCGAGTAAATATGGTCTCCCAGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027490.1-427s21c1
Sequence:CCGGCGACTTACGGTGCAATTATTCCTCGAGGAATAATTGCACCGTAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027490
VALIDATED
DCP2 MISSION shRNA Lentiviral Transduction Particles
decapping mRNA 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027490.1-176s21c1
Sequence:CCGGTGATCTCTGCAGCCGATTTATCTCGAGATAAATCGGCTGCAGAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027490.1-785s21c1
Sequence:CCGGGCTTGGCTTGGCACCTAATAACTCGAGTTATTAGGTGCCAAGCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027490.1-843s21c1
Sequence:CCGGGACTGGCTGTCTCGAAGATTTCTCGAGAAATCTTCGAGACAGCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027490.1-3540s21c1
Sequence:CCGGTTAGCTGGGAGACCATATTTACTCGAGTAAATATGGTCTCCCAGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027490.1-427s21c1
Sequence:CCGGCGACTTACGGTGCAATTATTCCTCGAGGAATAATTGCACCGTAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)