EMAIL THIS PAGE TO A FRIEND

DCPS

decapping enzyme, scavenger

49 Gene Product Result for
Synonyms: DCS1 HINT-5 HINT5 HSL1
UniProtKB ID: Q96C86, Q8NHL8, Q9Y2S5
Gene ID:
Mouse(69305) decapping enzyme, scavenger
Rat(266605) decapping enzyme, scavenger
sheep(101114475) decapping enzyme, scavenger
domestic guinea pig(100731112) decapping enzyme, scavenger
naked mole-rat(101715664) decapping enzyme, scavenger
Zebrafish(402850) mRNA decapping enzyme
cow(282640) decapping enzyme, scavenger
domestic cat(101088950) decapping enzyme, scavenger
dog(609536) decapping enzyme, scavenger
chicken(419716) decapping enzyme, scavenger
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014026 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014026 Rosetta Predictions human pricing
NM_153302 Rosetta Predictions rat pricing
NM_027030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159613 predicted 838
2 SASI_Hs01_00159614 predicted 427
3 SASI_Hs01_00159615 predicted 963
4 SASI_Hs01_00159616 predicted 902
5 SASI_Hs01_00159617 predicted 1098
6 SASI_Hs02_00345004 predicted 872
7 SASI_Hs01_00159618 predicted 843
8 SASI_Hs01_00159619 predicted 1244
9 SASI_Hs01_00159620 predicted 790
10 SASI_Hs01_00159621 predicted 968
11 SASI_Hs01_00159622 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074306 predicted 633
2 SASI_Rn01_00074307 predicted 228
3 SASI_Rn01_00074308 predicted 302
4 SASI_Rn01_00074309 predicted 751
5 SASI_Rn01_00074310 predicted 342
6 SASI_Rn01_00074311 predicted 245
7 SASI_Rn01_00074312 predicted 554
8 SASI_Rn01_00074313 predicted 720
9 SASI_Rn01_00074314 predicted 398
10 SASI_Rn01_00074315 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133312 predicted 490
2 SASI_Mm01_00133313 predicted 814
3 SASI_Mm01_00133314 predicted 526
4 SASI_Mm01_00133315 predicted 486
5 SASI_Mm01_00133316 predicted 327
6 SASI_Mm01_00133317 predicted 649
7 SASI_Mm01_00133318 predicted 470
8 SASI_Mm01_00133319 predicted 446
9 SASI_Mm01_00133320 predicted 891
10 SASI_Mm01_00133321 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027030
VALIDATED
DCPS MISSION shRNA Bacterial Glycerol Stock
decapping enzyme, scavenger
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-802s21c1
Sequence:CCGGTCTGCGAGTGTACCTACACTACTCGAGTAGTGTAGGTACACTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-331s21c1
Sequence:CCGGGTTGCAGTTCTCCAATGATATCTCGAGATATCATTGGAGAACTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-835s21c1
Sequence:CCGGCTATCACCTGCACGTGCATTTCTCGAGAAATGCACGTGCAGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-377s21c1
Sequence:CCGGCCAAGGCATCTGAGTGATATACTCGAGTATATCACTCAGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-649s21c1
Sequence:CCGGGCAGCTTGATGACCTGTATTTCTCGAGAAATACAGGTCATCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-378s1c1
Sequence:CCGGCCAAGGCATCTGAGTGATATACTCGAGTATATCACTCAGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-650s1c1
Sequence:CCGGGCAGCTTGATGACCTGTATTTCTCGAGAAATACAGGTCATCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-803s1c1
Sequence:CCGGTCTGCGAGTGTACCTACACTACTCGAGTAGTGTAGGTACACTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-148s1c1
Sequence:CCGGTCTCCGGCTTTAGAGTACAAACTCGAGTTTGTACTCTAAAGCCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027030
VALIDATED
DCPS MISSION shRNA shRNA Plasmid DNA
decapping enzyme, scavenger
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-802s21c1
Sequence:CCGGTCTGCGAGTGTACCTACACTACTCGAGTAGTGTAGGTACACTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-331s21c1
Sequence:CCGGGTTGCAGTTCTCCAATGATATCTCGAGATATCATTGGAGAACTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-835s21c1
Sequence:CCGGCTATCACCTGCACGTGCATTTCTCGAGAAATGCACGTGCAGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-377s21c1
Sequence:CCGGCCAAGGCATCTGAGTGATATACTCGAGTATATCACTCAGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-649s21c1
Sequence:CCGGGCAGCTTGATGACCTGTATTTCTCGAGAAATACAGGTCATCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-378s1c1
Sequence:CCGGCCAAGGCATCTGAGTGATATACTCGAGTATATCACTCAGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-650s1c1
Sequence:CCGGGCAGCTTGATGACCTGTATTTCTCGAGAAATACAGGTCATCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-803s1c1
Sequence:CCGGTCTGCGAGTGTACCTACACTACTCGAGTAGTGTAGGTACACTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-148s1c1
Sequence:CCGGTCTCCGGCTTTAGAGTACAAACTCGAGTTTGTACTCTAAAGCCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027030
VALIDATED
DCPS MISSION shRNA Lentiviral Transduction Particles
decapping enzyme, scavenger
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-802s21c1
Sequence:CCGGTCTGCGAGTGTACCTACACTACTCGAGTAGTGTAGGTACACTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-331s21c1
Sequence:CCGGGTTGCAGTTCTCCAATGATATCTCGAGATATCATTGGAGAACTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-835s21c1
Sequence:CCGGCTATCACCTGCACGTGCATTTCTCGAGAAATGCACGTGCAGGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-377s21c1
Sequence:CCGGCCAAGGCATCTGAGTGATATACTCGAGTATATCACTCAGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027030.2-649s21c1
Sequence:CCGGGCAGCTTGATGACCTGTATTTCTCGAGAAATACAGGTCATCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-378s1c1
Sequence:CCGGCCAAGGCATCTGAGTGATATACTCGAGTATATCACTCAGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-650s1c1
Sequence:CCGGGCAGCTTGATGACCTGTATTTCTCGAGAAATACAGGTCATCAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-803s1c1
Sequence:CCGGTCTGCGAGTGTACCTACACTACTCGAGTAGTGTAGGTACACTCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027030.1-148s1c1
Sequence:CCGGTCTCCGGCTTTAGAGTACAAACTCGAGTTTGTACTCTAAAGCCGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014026
VALIDATED
DCPS MISSION shRNA Bacterial Glycerol Stock
decapping enzyme, scavenger
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-647s21c1
Sequence:CCGGGCAGTTCTCCAATGATATCTACTCGAGTAGATATCATTGGAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-1106s21c1
Sequence:CCGGGGGAGACCATCTGCGAGTATACTCGAGTATACTCGCAGATGGTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-965s21c1
Sequence:CCGGGCTCGATGACTTGTACTTGATCTCGAGATCAAGTACAAGTCATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-1351s21c1
Sequence:CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-1351s1c1
Sequence:CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-965s1c1
Sequence:CCGGGCTCGATGACTTGTACTTGATCTCGAGATCAAGTACAAGTCATCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-647s1c1
Sequence:CCGGGCAGTTCTCCAATGATATCTACTCGAGTAGATATCATTGGAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-691s1c1
Sequence:CCGGCAAGACAACTGAATGATGTAACTCGAGTTACATCATTCAGTTGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014026.3-842s1c1
Sequence:CCGGCAGCATCCAGTGGGTGTATAACTCGAGTTATACACCCACTGGATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014026
VALIDATED
DCPS MISSION shRNA shRNA Plasmid DNA
decapping enzyme, scavenger
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-647s21c1
Sequence:CCGGGCAGTTCTCCAATGATATCTACTCGAGTAGATATCATTGGAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-1106s21c1
Sequence:CCGGGGGAGACCATCTGCGAGTATACTCGAGTATACTCGCAGATGGTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-965s21c1
Sequence:CCGGGCTCGATGACTTGTACTTGATCTCGAGATCAAGTACAAGTCATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-1351s21c1
Sequence:CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-1351s1c1
Sequence:CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-965s1c1
Sequence:CCGGGCTCGATGACTTGTACTTGATCTCGAGATCAAGTACAAGTCATCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-647s1c1
Sequence:CCGGGCAGTTCTCCAATGATATCTACTCGAGTAGATATCATTGGAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-691s1c1
Sequence:CCGGCAAGACAACTGAATGATGTAACTCGAGTTACATCATTCAGTTGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014026.3-842s1c1
Sequence:CCGGCAGCATCCAGTGGGTGTATAACTCGAGTTATACACCCACTGGATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014026
VALIDATED
DCPS MISSION shRNA Lentiviral Transduction Particles
decapping enzyme, scavenger
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-647s21c1
Sequence:CCGGGCAGTTCTCCAATGATATCTACTCGAGTAGATATCATTGGAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-1106s21c1
Sequence:CCGGGGGAGACCATCTGCGAGTATACTCGAGTATACTCGCAGATGGTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-965s21c1
Sequence:CCGGGCTCGATGACTTGTACTTGATCTCGAGATCAAGTACAAGTCATCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014026.3-1351s21c1
Sequence:CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-1351s1c1
Sequence:CCGGCAGGCAGAAGAGCACAGATGTCTCGAGACATCTGTGCTCTTCTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-965s1c1
Sequence:CCGGGCTCGATGACTTGTACTTGATCTCGAGATCAAGTACAAGTCATCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-647s1c1
Sequence:CCGGGCAGTTCTCCAATGATATCTACTCGAGTAGATATCATTGGAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014026.3-691s1c1
Sequence:CCGGCAAGACAACTGAATGATGTAACTCGAGTTACATCATTCAGTTGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014026.3-842s1c1
Sequence:CCGGCAGCATCCAGTGGGTGTATAACTCGAGTTATACACCCACTGGATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks