EMAIL THIS PAGE TO A FRIEND

DCST1

DC-STAMP domain containing 1

58 Gene Product Result for
Gene ID:
Human(149095) Summary: This gene encodes a protein with a domain similar to one found in dendritic cells (PMID:11169400) which play a key role in antigen processing and display for immune responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(77772) DC-STAMP domain containing 1
Rat(295246) DC-STAMP domain containing 1
Zebrafish(556016) DC-STAMP domain containing 1
domestic cat(101095548) DC-STAMP domain containing 1
cow(521797) DC-STAMP domain containing 1
Horse(100063149) DC-STAMP domain containing 1
dog(490435) DC-STAMP domain containing 1
sheep(101115170) DC-STAMP domain containing 1
Domestic Rabbit(100345431) DC-STAMP domain containing 1
naked mole-rat(101703146) DC-STAMP domain containing 1
domestic guinea pig(100732133) DC-STAMP domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152494 Rosetta Predictions human pricing
XM_001074533 Rosetta Predictions rat pricing
NM_029974 Rosetta Predictions mouse pricing
XM_130969 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238575 predicted 316
2 SASI_Hs01_00238576 predicted 1025
3 SASI_Hs02_00366269 predicted 1523
4 SASI_Hs01_00238579 predicted 1285
5 SASI_Hs01_00238580 predicted 318
6 SASI_Hs01_00238581 predicted 504
7 SASI_Hs01_00238582 predicted 224
8 SASI_Hs02_00366270 predicted 1286
9 SASI_Hs01_00238584 predicted 875
10 SASI_Hs02_00366271 predicted 1238
11 SASI_Hs01_00238577 predicted 1329
12 SASI_Hs01_00238578 predicted 1597
13 SASI_Hs01_00238583 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346576 predicted 1079
2 SASI_Rn02_00346577 predicted 616
3 SASI_Rn02_00346578 predicted 1315
4 SASI_Rn02_00346579 predicted 781
5 SASI_Rn02_00346580 predicted 1871
6 SASI_Rn02_00346581 predicted 1667
7 SASI_Rn02_00346582 predicted 823
8 SASI_Rn02_00346583 predicted 1262
9 SASI_Rn02_00346584 predicted 937
10 SASI_Rn02_00346585 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336296 predicted 1957
2 SASI_Mm02_00336297 predicted 531
3 SASI_Mm02_00336298 predicted 1808
4 SASI_Mm02_00336299 predicted 1990
5 SASI_Mm02_00336300 predicted 364
6 SASI_Mm02_00336301 predicted 1423
7 SASI_Mm02_00336302 predicted 861
8 SASI_Mm02_00336303 predicted 506
9 SASI_Mm02_00336304 predicted 1118
10 SASI_Mm02_00336305 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274735 predicted 1177
2 SASI_Mm01_00274736 predicted 1968
3 SASI_Mm01_00274737 predicted 1534
4 SASI_Mm01_00274738 predicted 1415
5 SASI_Mm01_00274739 predicted 1825
6 SASI_Mm01_00274740 predicted 1706
7 SASI_Mm01_00274741 predicted 1438
8 SASI_Mm01_00274742 predicted 1359
9 SASI_Mm01_00274743 predicted 1745
10 SASI_Mm01_00274744 predicted 1680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152494
DCST1 MISSION shRNA Bacterial Glycerol Stock
DC-STAMP domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-307s1c1
Sequence:CCGGCCCATGAACATCTACGAAGAACTCGAGTTCTTCGTAGATGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-1676s1c1
Sequence:CCGGCCTCAGAGACAGTGATGGAATCTCGAGATTCCATCACTGTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-1875s1c1
Sequence:CCGGCCTCTACAATGACCTATTGAACTCGAGTTCAATAGGTCATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-948s1c1
Sequence:CCGGCCTGCCTATGAAGTTCAAGTTCTCGAGAACTTGAACTTCATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-951s1c1
Sequence:CCGGGCCTATGAAGTTCAAGTTCTTCTCGAGAAGAACTTGAACTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152494
DCST1 MISSION shRNA shRNA Plasmid DNA
DC-STAMP domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-307s1c1
Sequence:CCGGCCCATGAACATCTACGAAGAACTCGAGTTCTTCGTAGATGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-1676s1c1
Sequence:CCGGCCTCAGAGACAGTGATGGAATCTCGAGATTCCATCACTGTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-1875s1c1
Sequence:CCGGCCTCTACAATGACCTATTGAACTCGAGTTCAATAGGTCATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-948s1c1
Sequence:CCGGCCTGCCTATGAAGTTCAAGTTCTCGAGAACTTGAACTTCATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-951s1c1
Sequence:CCGGGCCTATGAAGTTCAAGTTCTTCTCGAGAAGAACTTGAACTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152494
DCST1 MISSION shRNA Lentiviral Transduction Particles
DC-STAMP domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-307s1c1
Sequence:CCGGCCCATGAACATCTACGAAGAACTCGAGTTCTTCGTAGATGTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-1676s1c1
Sequence:CCGGCCTCAGAGACAGTGATGGAATCTCGAGATTCCATCACTGTCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-1875s1c1
Sequence:CCGGCCTCTACAATGACCTATTGAACTCGAGTTCAATAGGTCATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-948s1c1
Sequence:CCGGCCTGCCTATGAAGTTCAAGTTCTCGAGAACTTGAACTTCATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152494.1-951s1c1
Sequence:CCGGGCCTATGAAGTTCAAGTTCTTCTCGAGAAGAACTTGAACTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029974
DCST1 MISSION shRNA Bacterial Glycerol Stock
DC-STAMP domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-1700s21c1
Sequence:CCGGCTCGCCAAGCTTCTTCGTAAACTCGAGTTTACGAAGAAGCTTGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-898s21c1
Sequence:CCGGACGCTGCATCCATGTAGTAAACTCGAGTTTACTACATGGATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-1153s21c1
Sequence:CCGGTTCAGCCAATATTAACCTTAACTCGAGTTAAGGTTAATATTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-582s21c1
Sequence:CCGGCCAACATCAACGAGGTGATAGCTCGAGCTATCACCTCGTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029974
DCST1 MISSION shRNA shRNA Plasmid DNA
DC-STAMP domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-1700s21c1
Sequence:CCGGCTCGCCAAGCTTCTTCGTAAACTCGAGTTTACGAAGAAGCTTGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-898s21c1
Sequence:CCGGACGCTGCATCCATGTAGTAAACTCGAGTTTACTACATGGATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-1153s21c1
Sequence:CCGGTTCAGCCAATATTAACCTTAACTCGAGTTAAGGTTAATATTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-582s21c1
Sequence:CCGGCCAACATCAACGAGGTGATAGCTCGAGCTATCACCTCGTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029974
DCST1 MISSION shRNA Lentiviral Transduction Particles
DC-STAMP domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-1700s21c1
Sequence:CCGGCTCGCCAAGCTTCTTCGTAAACTCGAGTTTACGAAGAAGCTTGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-898s21c1
Sequence:CCGGACGCTGCATCCATGTAGTAAACTCGAGTTTACTACATGGATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-1153s21c1
Sequence:CCGGTTCAGCCAATATTAACCTTAACTCGAGTTAAGGTTAATATTGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029974.1-582s21c1
Sequence:CCGGCCAACATCAACGAGGTGATAGCTCGAGCTATCACCTCGTTGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks