EMAIL THIS PAGE TO A FRIEND

DCST2

DC-STAMP domain containing 2

UniProtKB ID: Q5T1A1, Q2M2R2, Q8N810, Q96M03
Gene ID:
Mouse(329702) DC-STAMP domain containing 2
Rat(295247) DC-STAMP domain containing 2
domestic guinea pig(100731867) DC-STAMP domain containing 2
naked mole-rat(101703495) DC-STAMP domain containing 2
sheep(101104880) DC-STAMP domain containing 2
Zebrafish(556296) DC-STAMP domain containing 2
cow(521798) DC-STAMP domain containing 2
Horse(100063120) DC-STAMP domain containing 2
domestic cat(101095794) DC-STAMP domain containing 2
dog(490436) DC-STAMP domain containing 2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144622 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122761 MISSION® esiRNA esiRNA human DCST2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144622 Rosetta Predictions human pricing
XM_001074559 Rosetta Predictions rat pricing
XM_227418 Rosetta Predictions rat pricing
XM_283860 Rosetta Predictions mouse pricing
XM_910066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364443 predicted 1493
2 SASI_Hs01_00078861 predicted 730
3 SASI_Hs01_00078862 predicted 576
4 SASI_Hs01_00078863 predicted 1710
5 SASI_Hs01_00078864 predicted 534
6 SASI_Hs01_00078865 predicted 1569
7 SASI_Hs01_00078866 predicted 768
8 SASI_Hs01_00078867 predicted 1622
9 SASI_Hs01_00078868 predicted 1298
10 SASI_Hs01_00078869 predicted 842
11 SASI_Hs01_00078860 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346650 predicted 1531
2 SASI_Rn02_00346651 predicted 807
3 SASI_Rn02_00346652 predicted 606
4 SASI_Rn02_00346653 predicted 598
5 SASI_Rn02_00346654 predicted 877
6 SASI_Rn02_00346655 predicted 728
7 SASI_Rn02_00346656 predicted 608
8 SASI_Rn02_00346657 predicted 721
9 SASI_Rn02_00346658 predicted 771
10 SASI_Rn02_00346659 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172156 predicted 221
2 SASI_Rn01_00172157 predicted 245
3 SASI_Rn01_00172158 predicted 212
4 SASI_Rn01_00172159 predicted 214
5 SASI_Rn01_00172160 predicted 261
6 SASI_Rn01_00172161 predicted 306
7 SASI_Rn01_00172162 predicted 292
8 SASI_Rn01_00172163 predicted 284
9 SASI_Rn01_00172164 predicted 280
10 SASI_Rn01_00172165 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268036 predicted 986
2 SASI_Mm01_00268037 predicted 792
3 SASI_Mm01_00268038 predicted 1748
4 SASI_Mm02_00425627 predicted 1475
5 SASI_Mm01_00268039 predicted 653
6 SASI_Mm01_00268040 predicted 406
7 SASI_Mm01_00268041 predicted 1534
8 SASI_Mm01_00268042 predicted 775
9 SASI_Mm01_00268043 predicted 460
10 SASI_Mm01_00268044 predicted 1533
11 SASI_Mm01_00268035 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435349 predicted 983
2 SASI_Mm02_00435350 predicted 799
3 SASI_Mm02_00435351 predicted 1742
4 SASI_Mm02_00435352 predicted 1473
5 SASI_Mm02_00435353 predicted 652
6 SASI_Mm02_00435354 predicted 404
7 SASI_Mm02_00435355 predicted 1531
8 SASI_Mm02_00435356 predicted 773
9 SASI_Mm02_00435357 predicted 462
10 SASI_Mm02_00435358 predicted 1537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144622
DCST2 MISSION shRNA Bacterial Glycerol Stock
DC-STAMP domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-1510s21c1
Sequence:CCGGAGCAAGGCAACATCAGTATTTCTCGAGAAATACTGATGTTGCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-579s21c1
Sequence:CCGGCGCAAGTTCTTTCGGTCAATCCTCGAGGATTGACCGAAAGAACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-1129s21c1
Sequence:CCGGACTGGGACCATTATGACAATACTCGAGTATTGTCATAATGGTCCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-2005s1c1
Sequence:CCGGGATGGTTCATCCAGGTCTCTACTCGAGTAGAGACCTGGATGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-1945s1c1
Sequence:CCGGGCCAAGGATTTATATGCAAGTCTCGAGACTTGCATATAAATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-524s1c1
Sequence:CCGGCCTGAACAAGATTAAAGCTATCTCGAGATAGCTTTAATCTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-523s1c1
Sequence:CCGGCCCTGAACAAGATTAAAGCTACTCGAGTAGCTTTAATCTTGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144622
DCST2 MISSION shRNA shRNA Plasmid DNA
DC-STAMP domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-1510s21c1
Sequence:CCGGAGCAAGGCAACATCAGTATTTCTCGAGAAATACTGATGTTGCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-579s21c1
Sequence:CCGGCGCAAGTTCTTTCGGTCAATCCTCGAGGATTGACCGAAAGAACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-1129s21c1
Sequence:CCGGACTGGGACCATTATGACAATACTCGAGTATTGTCATAATGGTCCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-2005s1c1
Sequence:CCGGGATGGTTCATCCAGGTCTCTACTCGAGTAGAGACCTGGATGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-1945s1c1
Sequence:CCGGGCCAAGGATTTATATGCAAGTCTCGAGACTTGCATATAAATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-524s1c1
Sequence:CCGGCCTGAACAAGATTAAAGCTATCTCGAGATAGCTTTAATCTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-523s1c1
Sequence:CCGGCCCTGAACAAGATTAAAGCTACTCGAGTAGCTTTAATCTTGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144622
DCST2 MISSION shRNA Lentiviral Transduction Particles
DC-STAMP domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-1510s21c1
Sequence:CCGGAGCAAGGCAACATCAGTATTTCTCGAGAAATACTGATGTTGCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-579s21c1
Sequence:CCGGCGCAAGTTCTTTCGGTCAATCCTCGAGGATTGACCGAAAGAACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144622.2-1129s21c1
Sequence:CCGGACTGGGACCATTATGACAATACTCGAGTATTGTCATAATGGTCCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-2005s1c1
Sequence:CCGGGATGGTTCATCCAGGTCTCTACTCGAGTAGAGACCTGGATGAACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-1945s1c1
Sequence:CCGGGCCAAGGATTTATATGCAAGTCTCGAGACTTGCATATAAATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-524s1c1
Sequence:CCGGCCTGAACAAGATTAAAGCTATCTCGAGATAGCTTTAATCTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144622.1-523s1c1
Sequence:CCGGCCCTGAACAAGATTAAAGCTACTCGAGTAGCTTTAATCTTGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks