EMAIL THIS PAGE TO A FRIEND

DCSTAMP

dendrocyte expressed seven transmembrane protein

57 Gene Product Result for
Synonyms: FIND TM7SF4 hDC-STAMP
UniProtKB ID: Q9H295, B7ZVW2, E7ESG0, Q2M2D5
Gene ID:
Human(81501) Summary: This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Mouse(75766) dentrocyte expressed seven transmembrane protein
Rat(299889) dendrocyte expressed seven transmembrane protein
chicken(420265) dendrocyte expressed seven transmembrane protein
domestic cat(101081191) dendrocyte expressed seven transmembrane protein
cow(512133) dendrocyte expressed seven transmembrane protein
sheep(101102317) dendrocyte expressed seven transmembrane protein
naked mole-rat(101698860) dendrocyte expressed seven transmembrane protein
domestic guinea pig(100718078) dendrocyte expressed seven transmembrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030788 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012021 MISSION® esiRNA esiRNA targeting human TM7SF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030788 Rosetta Predictions human pricing
XM_001062083 Rosetta Predictions rat pricing
XM_235262 Rosetta Predictions rat pricing
NM_029422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030989 predicted 968
2 SASI_Hs01_00030990 predicted 1296
3 SASI_Hs01_00030991 predicted 414
4 SASI_Hs01_00030992 predicted 1519
5 SASI_Hs01_00030993 predicted 1325
6 SASI_Hs01_00030994 predicted 672
7 SASI_Hs01_00030996 predicted 1087
8 SASI_Hs02_00358337 predicted 333
9 SASI_Hs01_00030997 predicted 1079
10 SASI_Hs01_00030998 predicted 1218
11 SASI_Hs01_00030995 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302357 predicted 732
2 SASI_Rn02_00302358 predicted 1176
3 SASI_Rn02_00302359 predicted 1128
4 SASI_Rn02_00302360 predicted 1119
5 SASI_Rn02_00302361 predicted 310
6 SASI_Rn02_00302362 predicted 375
7 SASI_Rn02_00302363 predicted 1160
8 SASI_Rn02_00302364 predicted 736
9 SASI_Rn02_00302365 predicted 717
10 SASI_Rn02_00302366 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389144 predicted 728
2 SASI_Rn02_00389145 predicted 1176
3 SASI_Rn02_00389146 predicted 1126
4 SASI_Rn02_00389147 predicted 1122
5 SASI_Rn02_00389148 predicted 313
6 SASI_Rn02_00389149 predicted 376
7 SASI_Rn02_00389150 predicted 1157
8 SASI_Rn02_00389151 predicted 737
9 SASI_Rn02_00389152 predicted 717
10 SASI_Rn02_00389153 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119198 predicted 1106
2 SASI_Mm01_00119199 predicted 363
3 SASI_Mm01_00119200 predicted 1196
4 SASI_Mm01_00119201 predicted 1102
5 SASI_Mm01_00119202 predicted 1222
6 SASI_Mm01_00119203 predicted 1104
7 SASI_Mm01_00119204 predicted 1106
8 SASI_Mm01_00119205 predicted 596
9 SASI_Mm02_00335322 predicted 333
10 SASI_Mm01_00119206 predicted 766
11 SASI_Mm01_00119207 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030788
DCSTAMP MISSION shRNA Bacterial Glycerol Stock
dendrocyte expressed seven transmembrane protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-599s1c1
Sequence:CCGGGCACAGCTAAATGACAGCAAACTCGAGTTTGCTGTCATTTAGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-156s1c1
Sequence:CCGGGCTGTTTGGTTGCTCTTATTTCTCGAGAAATAAGAGCAACCAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-902s1c1
Sequence:CCGGCCGACTCCTAAAGAAAGGAAACTCGAGTTTCCTTTCTTTAGGAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-82s1c1
Sequence:CCGGCCTAAGTCTTTGGGAGATTTACTCGAGTAAATCTCCCAAAGACTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-1366s1c1
Sequence:CCGGGCTGAGTCTCTATCTTACAAACTCGAGTTTGTAAGATAGAGACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030788.2-993s21c1
Sequence:CCGGATCTGCTGTATCGGCTCATTTCTCGAGAAATGAGCCGATACAGCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030788.2-1231s21c1
Sequence:CCGGCTCTATCCTTATGCAACTTAACTCGAGTTAAGTTGCATAAGGATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030788.2-1526s21c1
Sequence:CCGGCACTATTCATGCCGGATAATACTCGAGTATTATCCGGCATGAATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030788
DCSTAMP MISSION shRNA shRNA Plasmid DNA
dendrocyte expressed seven transmembrane protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-599s1c1
Sequence:CCGGGCACAGCTAAATGACAGCAAACTCGAGTTTGCTGTCATTTAGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-156s1c1
Sequence:CCGGGCTGTTTGGTTGCTCTTATTTCTCGAGAAATAAGAGCAACCAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-902s1c1
Sequence:CCGGCCGACTCCTAAAGAAAGGAAACTCGAGTTTCCTTTCTTTAGGAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-82s1c1
Sequence:CCGGCCTAAGTCTTTGGGAGATTTACTCGAGTAAATCTCCCAAAGACTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-1366s1c1
Sequence:CCGGGCTGAGTCTCTATCTTACAAACTCGAGTTTGTAAGATAGAGACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030788.2-993s21c1
Sequence:CCGGATCTGCTGTATCGGCTCATTTCTCGAGAAATGAGCCGATACAGCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030788.2-1231s21c1
Sequence:CCGGCTCTATCCTTATGCAACTTAACTCGAGTTAAGTTGCATAAGGATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030788.2-1526s21c1
Sequence:CCGGCACTATTCATGCCGGATAATACTCGAGTATTATCCGGCATGAATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030788
DCSTAMP MISSION shRNA Lentiviral Transduction Particles
dendrocyte expressed seven transmembrane protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-599s1c1
Sequence:CCGGGCACAGCTAAATGACAGCAAACTCGAGTTTGCTGTCATTTAGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-156s1c1
Sequence:CCGGGCTGTTTGGTTGCTCTTATTTCTCGAGAAATAAGAGCAACCAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-902s1c1
Sequence:CCGGCCGACTCCTAAAGAAAGGAAACTCGAGTTTCCTTTCTTTAGGAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-82s1c1
Sequence:CCGGCCTAAGTCTTTGGGAGATTTACTCGAGTAAATCTCCCAAAGACTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030788.2-1366s1c1
Sequence:CCGGGCTGAGTCTCTATCTTACAAACTCGAGTTTGTAAGATAGAGACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030788.2-993s21c1
Sequence:CCGGATCTGCTGTATCGGCTCATTTCTCGAGAAATGAGCCGATACAGCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030788.2-1231s21c1
Sequence:CCGGCTCTATCCTTATGCAACTTAACTCGAGTTAAGTTGCATAAGGATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030788.2-1526s21c1
Sequence:CCGGCACTATTCATGCCGGATAATACTCGAGTATTATCCGGCATGAATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128030
DCSTAMP MISSION shRNA Bacterial Glycerol Stock
dendrocyte expressed seven transmembrane protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1017s1c1
Sequence:CCGGCCATGAACAAACAGTTCCAAACTCGAGTTTGGAACTGTTTGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1271s1c1
Sequence:CCGGCCTGCAAATGAAGATGATCTACTCGAGTAGATCATCTTCATTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-229s1c1
Sequence:CCGGGCTCTCTTCTGTCTGGATGATCTCGAGATCATCCAGACAGAAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-983s1c1
Sequence:CCGGGCTGTGGACTATCTGCTGTATCTCGAGATACAGCAGATAGTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1150s1c1
Sequence:CCGGGCTCCTTGAGAAACGATCAAACTCGAGTTTGATCGTTTCTCAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128030
DCSTAMP MISSION shRNA shRNA Plasmid DNA
dendrocyte expressed seven transmembrane protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1017s1c1
Sequence:CCGGCCATGAACAAACAGTTCCAAACTCGAGTTTGGAACTGTTTGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1271s1c1
Sequence:CCGGCCTGCAAATGAAGATGATCTACTCGAGTAGATCATCTTCATTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-229s1c1
Sequence:CCGGGCTCTCTTCTGTCTGGATGATCTCGAGATCATCCAGACAGAAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-983s1c1
Sequence:CCGGGCTGTGGACTATCTGCTGTATCTCGAGATACAGCAGATAGTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1150s1c1
Sequence:CCGGGCTCCTTGAGAAACGATCAAACTCGAGTTTGATCGTTTCTCAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128030
DCSTAMP MISSION shRNA Lentiviral Transduction Particles
dendrocyte expressed seven transmembrane protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1017s1c1
Sequence:CCGGCCATGAACAAACAGTTCCAAACTCGAGTTTGGAACTGTTTGTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1271s1c1
Sequence:CCGGCCTGCAAATGAAGATGATCTACTCGAGTAGATCATCTTCATTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-229s1c1
Sequence:CCGGGCTCTCTTCTGTCTGGATGATCTCGAGATCATCCAGACAGAAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-983s1c1
Sequence:CCGGGCTGTGGACTATCTGCTGTATCTCGAGATACAGCAGATAGTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128030.2-1150s1c1
Sequence:CCGGGCTCCTTGAGAAACGATCAAACTCGAGTTTGATCGTTTCTCAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)