EMAIL THIS PAGE TO A FRIEND

DCT

dopachrome tautomerase

62 Gene Product Result for
Synonyms: TRP-2 TYRP2
UniProtKB ID: P40126, Q09GT4
Gene ID:
Mouse(13190) dopachrome tautomerase
Rat(290484) dopachrome tautomerase
sheep(100170232) dopachrome tautomerase
domestic guinea pig(100718804) dopachrome tautomerase
naked mole-rat(101716269) dopachrome tautomerase
Zebrafish(58074) dopachrome tautomerase
chicken(395775) dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)
cow(280761) dopachrome tautomerase
Horse(100058776) dopachrome tautomerase
domestic cat(101094977) dopachrome tautomerase
dog(485520) dopachrome tautomerase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048481 MISSION® esiRNA esiRNA human DCT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001922 Rosetta Predictions human pricing
XM_001078239 Rosetta Predictions rat pricing
XM_224517 Rosetta Predictions rat pricing
NM_010024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108083 predicted 843
2 SASI_Hs01_00108084 predicted 1454
3 SASI_Hs01_00108085 predicted 705
4 SASI_Hs01_00108086 predicted 1919
5 SASI_Hs02_00332811 predicted 1932
6 SASI_Hs01_00108088 predicted 711
7 SASI_Hs01_00108089 predicted 1672
8 SASI_Hs01_00108090 predicted 827
9 SASI_Hs01_00108092 predicted 1633
10 SASI_Hs02_00332812 predicted 1798
11 SASI_Hs01_00108087 predicted 1084
12 SASI_Hs01_00108091 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360087 predicted 1329
2 SASI_Rn02_00360088 predicted 1272
3 SASI_Rn02_00360089 predicted 715
4 SASI_Rn02_00360090 predicted 1162
5 SASI_Rn02_00360091 predicted 1039
6 SASI_Rn02_00360092 predicted 955
7 SASI_Rn02_00360093 predicted 1512
8 SASI_Rn02_00360094 predicted 1498
9 SASI_Rn02_00360095 predicted 988
10 SASI_Rn02_00360096 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382038 predicted 1330
2 SASI_Rn02_00382039 predicted 1274
3 SASI_Rn02_00382040 predicted 1159
4 SASI_Rn02_00382041 predicted 1594
5 SASI_Rn02_00382042 predicted 1234
6 SASI_Rn02_00382043 predicted 1038
7 SASI_Rn02_00382044 predicted 1775
8 SASI_Rn02_00382045 predicted 958
9 SASI_Rn02_00382046 predicted 1521
10 SASI_Rn02_00382047 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083205 predicted 1393
2 SASI_Mm01_00083206 predicted 1505
3 SASI_Mm01_00083207 predicted 1636
4 SASI_Mm01_00083208 predicted 1544
5 SASI_Mm01_00083209 predicted 1855
6 SASI_Mm01_00083210 predicted 1083
7 SASI_Mm01_00083211 predicted 602
8 SASI_Mm01_00083212 predicted 1778
9 SASI_Mm01_00083213 predicted 1555
10 SASI_Mm01_00083214 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001922
DCT MISSION shRNA Bacterial Glycerol Stock
dopachrome tautomerase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1830s21c1
Sequence:CCGGGTTGGCCCACAACTCTCTTAGCTCGAGCTAAGAGAGTTGTGGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001922.3-2107s21c1
Sequence:CCGGATAGTGATGATGATCTCATTCCTCGAGGAATGAGATCATCATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1056s21c1
Sequence:CCGGCACATCAAGGACCTGCATTTGCTCGAGCAAATGCAGGTCCTTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1474s21c1
Sequence:CCGGTGCTTTGGAAGGGTTTGATAACTCGAGTTATCAAACCCTTCCAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-802s21c1
Sequence:CCGGGATTCGGCAGAACATCCATTCCTCGAGGAATGGATGTTCTGCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001922.2-2026s1c1
Sequence:CCGGGCTGACAATAAAGGAACTAATCTCGAGATTAGTTCCTTTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1723s1c1
Sequence:CCGGCCTCCAGTGACTAATGAAGAACTCGAGTTCTTCATTAGTCACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-719s1c1
Sequence:CCGGCCGGCTATAATTGTGGAGACTCTCGAGAGTCTCCACAATTATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1434s1c1
Sequence:CCGGCCAGAACTCTACCTTCAGTTTCTCGAGAAACTGAAGGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1135s1c1
Sequence:CCGGGCTTTGCCCTACTGGAACTTTCTCGAGAAAGTTCCAGTAGGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001922
DCT MISSION shRNA shRNA Plasmid DNA
dopachrome tautomerase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1830s21c1
Sequence:CCGGGTTGGCCCACAACTCTCTTAGCTCGAGCTAAGAGAGTTGTGGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001922.3-2107s21c1
Sequence:CCGGATAGTGATGATGATCTCATTCCTCGAGGAATGAGATCATCATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1056s21c1
Sequence:CCGGCACATCAAGGACCTGCATTTGCTCGAGCAAATGCAGGTCCTTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1474s21c1
Sequence:CCGGTGCTTTGGAAGGGTTTGATAACTCGAGTTATCAAACCCTTCCAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-802s21c1
Sequence:CCGGGATTCGGCAGAACATCCATTCCTCGAGGAATGGATGTTCTGCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001922.2-2026s1c1
Sequence:CCGGGCTGACAATAAAGGAACTAATCTCGAGATTAGTTCCTTTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1723s1c1
Sequence:CCGGCCTCCAGTGACTAATGAAGAACTCGAGTTCTTCATTAGTCACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-719s1c1
Sequence:CCGGCCGGCTATAATTGTGGAGACTCTCGAGAGTCTCCACAATTATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1434s1c1
Sequence:CCGGCCAGAACTCTACCTTCAGTTTCTCGAGAAACTGAAGGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1135s1c1
Sequence:CCGGGCTTTGCCCTACTGGAACTTTCTCGAGAAAGTTCCAGTAGGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001922
DCT MISSION shRNA Lentiviral Transduction Particles
dopachrome tautomerase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1830s21c1
Sequence:CCGGGTTGGCCCACAACTCTCTTAGCTCGAGCTAAGAGAGTTGTGGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001922.3-2107s21c1
Sequence:CCGGATAGTGATGATGATCTCATTCCTCGAGGAATGAGATCATCATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1056s21c1
Sequence:CCGGCACATCAAGGACCTGCATTTGCTCGAGCAAATGCAGGTCCTTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-1474s21c1
Sequence:CCGGTGCTTTGGAAGGGTTTGATAACTCGAGTTATCAAACCCTTCCAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001922.3-802s21c1
Sequence:CCGGGATTCGGCAGAACATCCATTCCTCGAGGAATGGATGTTCTGCCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001922.2-2026s1c1
Sequence:CCGGGCTGACAATAAAGGAACTAATCTCGAGATTAGTTCCTTTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1723s1c1
Sequence:CCGGCCTCCAGTGACTAATGAAGAACTCGAGTTCTTCATTAGTCACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-719s1c1
Sequence:CCGGCCGGCTATAATTGTGGAGACTCTCGAGAGTCTCCACAATTATAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1434s1c1
Sequence:CCGGCCAGAACTCTACCTTCAGTTTCTCGAGAAACTGAAGGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001922.2-1135s1c1
Sequence:CCGGGCTTTGCCCTACTGGAACTTTCTCGAGAAAGTTCCAGTAGGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010024
VALIDATED
DCT MISSION shRNA Bacterial Glycerol Stock
dopachrome tautomerase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010024.1-1976s1c1
Sequence:CCGGTGACCTGGGTAGTAACTAATTCTCGAGAATTAGTTACTACCCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1125s1c1
Sequence:CCGGGCGTTGCCCTACTGGAACTTTCTCGAGAAAGTTCCAGTAGGGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1309s1c1
Sequence:CCGGCCTATGAAGGTTTGCTGAGAACTCGAGTTCTCAGCAAACCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-546s1c1
Sequence:CCGGGCAACCAACATCTGTGGATTTCTCGAGAAATCCACAGATGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1424s1c1
Sequence:CCGGCCAGAACTCTACCTTCAGCTTCTCGAGAAGCTGAAGGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010024
VALIDATED
DCT MISSION shRNA shRNA Plasmid DNA
dopachrome tautomerase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010024.1-1976s1c1
Sequence:CCGGTGACCTGGGTAGTAACTAATTCTCGAGAATTAGTTACTACCCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1125s1c1
Sequence:CCGGGCGTTGCCCTACTGGAACTTTCTCGAGAAAGTTCCAGTAGGGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1309s1c1
Sequence:CCGGCCTATGAAGGTTTGCTGAGAACTCGAGTTCTCAGCAAACCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-546s1c1
Sequence:CCGGGCAACCAACATCTGTGGATTTCTCGAGAAATCCACAGATGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1424s1c1
Sequence:CCGGCCAGAACTCTACCTTCAGCTTCTCGAGAAGCTGAAGGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010024
VALIDATED
DCT MISSION shRNA Lentiviral Transduction Particles
dopachrome tautomerase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010024.1-1976s1c1
Sequence:CCGGTGACCTGGGTAGTAACTAATTCTCGAGAATTAGTTACTACCCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1125s1c1
Sequence:CCGGGCGTTGCCCTACTGGAACTTTCTCGAGAAAGTTCCAGTAGGGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1309s1c1
Sequence:CCGGCCTATGAAGGTTTGCTGAGAACTCGAGTTCTCAGCAAACCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-546s1c1
Sequence:CCGGGCAACCAACATCTGTGGATTTCTCGAGAAATCCACAGATGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010024.1-1424s1c1
Sequence:CCGGCCAGAACTCTACCTTCAGCTTCTCGAGAAGCTGAAGGTAGAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks