EMAIL THIS PAGE TO A FRIEND

DCTD

dCMP deaminase

92 Gene Product Result for
UniProtKB ID: P32321, B2R836, D3DP49, D3DP50, Q5M7Z8, Q9BVD8
Gene ID:
Human(1635) Summary: The protein encoded by this gene catalyzes the deamination of dCMP to dUMP, the nucleotide substrate for thymidylate synthase. The encoded protein is allosterically activated by dCTP and inhibited by dTTP, and is found as a homohexamer. This protein uses zinc as a cofactor for its activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(320685) dCMP deaminase
Rat(290741) dCMP deaminase
Zebrafish(550332) dCMP deaminase
chicken(422556) dCMP deaminase
dog(607328) dCMP deaminase
domestic cat(101087658) dCMP deaminase
Horse(100051279) dCMP deaminase
cow(784292) dCMP deaminase
naked mole-rat(101725426) dCMP deaminase
Goat(100861073) dCMP deaminase
sheep(101108545) dCMP deaminase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001921 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086921 MISSION® esiRNA esiRNA human DCTD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012732 Rosetta Predictions human pricing
NM_001921 Rosetta Predictions human pricing
NM_001013882 Rosetta Predictions rat pricing
NM_178788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241841 predicted 730
2 SASI_Hs01_00241842 predicted 782
3 SASI_Hs01_00241843 predicted 756
4 SASI_Hs01_00241844 predicted 482
5 SASI_Hs01_00241845 predicted 682
6 SASI_Hs02_00306237 predicted 449
7 SASI_Hs01_00241847 predicted 771
8 SASI_Hs01_00241848 predicted 865
9 SASI_Hs01_00241849 predicted 876
10 SASI_Hs02_00306238 predicted 520
11 SASI_Hs01_00241846 predicted 505
12 SASI_Hs01_00241850 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037529 predicted 701
2 SASI_Hs01_00037530 predicted 760
3 SASI_Hs01_00037531 predicted 739
4 SASI_Hs01_00037532 predicted 462
5 SASI_Hs01_00037533 predicted 655
6 SASI_Hs02_00332809 predicted 432
7 SASI_Hs01_00037535 predicted 744
8 SASI_Hs01_00037536 predicted 843
9 SASI_Hs01_00037537 predicted 854
10 SASI_Hs02_00332810 predicted 493
11 SASI_Hs01_00037534 predicted 481
12 SASI_Hs01_00037538 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114419 predicted 962
2 SASI_Rn01_00114420 predicted 917
3 SASI_Rn02_00201156 predicted 359
4 SASI_Rn01_00114421 predicted 534
5 SASI_Rn01_00114422 predicted 265
6 SASI_Rn01_00114424 predicted 337
7 SASI_Rn01_00114425 predicted 468
8 SASI_Rn01_00114428 predicted 564
9 SASI_Rn02_00201157 predicted 917
10 SASI_Rn02_00201158 predicted 202
11 SASI_Rn01_00114423 predicted 356
12 SASI_Rn01_00114426 predicted 750
13 SASI_Rn01_00114427 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045822 predicted 1110
2 SASI_Mm01_00045823 predicted 1126
3 SASI_Mm01_00045824 predicted 489
4 SASI_Mm01_00045825 predicted 584
5 SASI_Mm01_00045826 predicted 1166
6 SASI_Mm02_00349384 predicted 1291
7 SASI_Mm01_00045827 predicted 576
8 SASI_Mm01_00045828 predicted 493
9 SASI_Mm01_00045830 predicted 461
10 SASI_Mm01_00045831 predicted 1231
11 SASI_Mm01_00045829 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178788
DCTD MISSION shRNA Bacterial Glycerol Stock
dCMP deaminase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-602s1c1
Sequence:CCGGCCGTGTAACGAATGTGCTAAACTCGAGTTTAGCACATTCGTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-345s1c1
Sequence:CCGGCCTTCTTGTCAGCACAAAGAACTCGAGTTCTTTGTGCTGACAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-499s1c1
Sequence:CCGGGCTGGATACTAAATATCCTTACTCGAGTAAGGATATTTAGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178788.2-1493s1c1
Sequence:CCGGCCTTGGTTTGTTGGTCACATACTCGAGTATGTGACCAACAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-650s1c1
Sequence:CCGGGTTATCTTCATGTCGGATAAACTCGAGTTTATCCGACATGAAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178788.4-1166s21c1
Sequence:CCGGCTCTGTCATCCACCATATTTCCTCGAGGAAATATGGTGGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178788.4-806s21c1
Sequence:CCGGTTGACTTTGATTCGATCAATACTCGAGTATTGATCGAATCAAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178788.4-1230s21c1
Sequence:CCGGATAATTGCTTCTCGTTCTTAGCTCGAGCTAAGAACGAGAAGCAATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178788
DCTD MISSION shRNA shRNA Plasmid DNA
dCMP deaminase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-602s1c1
Sequence:CCGGCCGTGTAACGAATGTGCTAAACTCGAGTTTAGCACATTCGTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-345s1c1
Sequence:CCGGCCTTCTTGTCAGCACAAAGAACTCGAGTTCTTTGTGCTGACAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-499s1c1
Sequence:CCGGGCTGGATACTAAATATCCTTACTCGAGTAAGGATATTTAGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178788.2-1493s1c1
Sequence:CCGGCCTTGGTTTGTTGGTCACATACTCGAGTATGTGACCAACAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-650s1c1
Sequence:CCGGGTTATCTTCATGTCGGATAAACTCGAGTTTATCCGACATGAAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178788.4-1166s21c1
Sequence:CCGGCTCTGTCATCCACCATATTTCCTCGAGGAAATATGGTGGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178788.4-806s21c1
Sequence:CCGGTTGACTTTGATTCGATCAATACTCGAGTATTGATCGAATCAAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178788.4-1230s21c1
Sequence:CCGGATAATTGCTTCTCGTTCTTAGCTCGAGCTAAGAACGAGAAGCAATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178788
DCTD MISSION shRNA Lentiviral Transduction Particles
dCMP deaminase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-602s1c1
Sequence:CCGGCCGTGTAACGAATGTGCTAAACTCGAGTTTAGCACATTCGTTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-345s1c1
Sequence:CCGGCCTTCTTGTCAGCACAAAGAACTCGAGTTCTTTGTGCTGACAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-499s1c1
Sequence:CCGGGCTGGATACTAAATATCCTTACTCGAGTAAGGATATTTAGTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119757    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178788.2-1493s1c1
Sequence:CCGGCCTTGGTTTGTTGGTCACATACTCGAGTATGTGACCAACAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178788.2-650s1c1
Sequence:CCGGGTTATCTTCATGTCGGATAAACTCGAGTTTATCCGACATGAAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178788.4-1166s21c1
Sequence:CCGGCTCTGTCATCCACCATATTTCCTCGAGGAAATATGGTGGATGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178788.4-806s21c1
Sequence:CCGGTTGACTTTGATTCGATCAATACTCGAGTATTGATCGAATCAAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178788.4-1230s21c1
Sequence:CCGGATAATTGCTTCTCGTTCTTAGCTCGAGCTAAGAACGAGAAGCAATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001921
VALIDATED
DCTD MISSION shRNA Bacterial Glycerol Stock
dCMP deaminase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-287s1c1
Sequence:CCGGCCGATGTGAAAGGCTGTAGTACTCGAGTACTACAGCCTTTCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-68s1c1
Sequence:CCGGCCTTCTTATCAGCACAGAGAACTCGAGTTCTCTGTGCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-313s1c1
Sequence:CCGGGTCGCCTTGTTCCCTTGTAATCTCGAGATTACAAGGGAACAAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-478s1c1
Sequence:CCGGAGCAAGATTGTCATTGACTTTCTCGAGAAAGTCAATGACAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001921.1-324s1c1
Sequence:CCGGCCCTTGTAATGAATGCGCTAACTCGAGTTAGCGCATTCATTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-592s21c1
Sequence:CCGGGCTGCGAGGCTCCTGTTTAATCTCGAGATTAAACAGGAGCCTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001921.2-1150s21c1
Sequence:CCGGCAAGTGAAGCATGGCATATAGCTCGAGCTATATGCCATGCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-390s21c1
Sequence:CCGGGAATAAGCTGGACACCAAATACTCGAGTATTTGGTGTCCAGCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-521s21c1
Sequence:CCGGTCATCATCCAGGCAGGTATAACTCGAGTTATACCTGCCTGGATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-317s21c1
Sequence:CCGGTTGTCGGGATTGGGTACAATGCTCGAGCATTGTACCCAATCCCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001921
VALIDATED
DCTD MISSION shRNA shRNA Plasmid DNA
dCMP deaminase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-287s1c1
Sequence:CCGGCCGATGTGAAAGGCTGTAGTACTCGAGTACTACAGCCTTTCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-68s1c1
Sequence:CCGGCCTTCTTATCAGCACAGAGAACTCGAGTTCTCTGTGCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-313s1c1
Sequence:CCGGGTCGCCTTGTTCCCTTGTAATCTCGAGATTACAAGGGAACAAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-478s1c1
Sequence:CCGGAGCAAGATTGTCATTGACTTTCTCGAGAAAGTCAATGACAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001921.1-324s1c1
Sequence:CCGGCCCTTGTAATGAATGCGCTAACTCGAGTTAGCGCATTCATTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-592s21c1
Sequence:CCGGGCTGCGAGGCTCCTGTTTAATCTCGAGATTAAACAGGAGCCTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001921.2-1150s21c1
Sequence:CCGGCAAGTGAAGCATGGCATATAGCTCGAGCTATATGCCATGCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-390s21c1
Sequence:CCGGGAATAAGCTGGACACCAAATACTCGAGTATTTGGTGTCCAGCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-521s21c1
Sequence:CCGGTCATCATCCAGGCAGGTATAACTCGAGTTATACCTGCCTGGATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-317s21c1
Sequence:CCGGTTGTCGGGATTGGGTACAATGCTCGAGCATTGTACCCAATCCCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001921
VALIDATED
DCTD MISSION shRNA Lentiviral Transduction Particles
dCMP deaminase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-287s1c1
Sequence:CCGGCCGATGTGAAAGGCTGTAGTACTCGAGTACTACAGCCTTTCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-68s1c1
Sequence:CCGGCCTTCTTATCAGCACAGAGAACTCGAGTTCTCTGTGCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-313s1c1
Sequence:CCGGGTCGCCTTGTTCCCTTGTAATCTCGAGATTACAAGGGAACAAGGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001921.1-478s1c1
Sequence:CCGGAGCAAGATTGTCATTGACTTTCTCGAGAAAGTCAATGACAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001921.1-324s1c1
Sequence:CCGGCCCTTGTAATGAATGCGCTAACTCGAGTTAGCGCATTCATTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-592s21c1
Sequence:CCGGGCTGCGAGGCTCCTGTTTAATCTCGAGATTAAACAGGAGCCTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001921.2-1150s21c1
Sequence:CCGGCAAGTGAAGCATGGCATATAGCTCGAGCTATATGCCATGCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-390s21c1
Sequence:CCGGGAATAAGCTGGACACCAAATACTCGAGTATTTGGTGTCCAGCTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-521s21c1
Sequence:CCGGTCATCATCCAGGCAGGTATAACTCGAGTTATACCTGCCTGGATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001921.2-317s21c1
Sequence:CCGGTTGTCGGGATTGGGTACAATGCTCGAGCATTGTACCCAATCCCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks