EMAIL THIS PAGE TO A FRIEND

DCTN1

dynactin 1

85 Gene Product Result for
Synonyms: DAP-150 DP-150 P135
Gene ID:
Human(1639) Summary: This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
Mouse(13191) dynactin 1
Rat(29167) dynactin 1
sheep(101116037) dynactin 1
chicken(426238) dynactin 1
dog(483106) dynactin 1
cow(511045) dynactin 1
Horse(100053938) dynactin 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004082 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064571 MISSION® esiRNA esiRNA targeting mouse Dctn1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004082 Rosetta Predictions human pricing
NM_023019 Rosetta Predictions human pricing
NM_024130 Rosetta Predictions rat pricing
NM_007835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065675 predicted 3665
2 SASI_Hs01_00065676 predicted 4525
3 SASI_Hs01_00065677 predicted 3627
4 SASI_Hs01_00065678 predicted 2189
5 SASI_Hs01_00065679 predicted 3652
6 SASI_Hs01_00065680 predicted 1797
7 SASI_Hs01_00065681 predicted 2966
8 SASI_Hs01_00065682 predicted 2902
9 SASI_Hs01_00065683 predicted 4418
10 SASI_Hs01_00065684 predicted 3645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177539 predicted 2467
2 SASI_Hs01_00177540 predicted 3322
3 SASI_Hs01_00177541 predicted 2423
4 SASI_Hs01_00177542 predicted 994
5 SASI_Hs01_00177543 predicted 2452
6 SASI_Hs01_00177544 predicted 599
7 SASI_Hs01_00177545 predicted 1758
8 SASI_Hs01_00177546 predicted 1699
9 SASI_Hs01_00177547 predicted 3218
10 SASI_Hs01_00177548 predicted 2441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042105 predicted 3125
2 SASI_Rn02_00263849 predicted 414
3 SASI_Rn01_00042106 predicted 4001
4 SASI_Rn01_00042107 predicted 1659
5 SASI_Rn01_00042108 predicted 3765
6 SASI_Rn01_00042109 predicted 2509
7 SASI_Rn01_00042110 predicted 492
8 SASI_Rn01_00042111 predicted 467
9 SASI_Rn01_00042112 predicted 4183
10 SASI_Rn01_00042113 predicted 2622
11 SASI_Rn01_00042104 predicted 3224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312571 predicted 4017
2 SASI_Mm01_00059652 predicted 2519
3 SASI_Mm01_00059654 predicted 2124
4 SASI_Mm02_00312572 predicted 3130
5 SASI_Mm02_00312573 predicted 524
6 SASI_Mm01_00059655 predicted 1344
7 SASI_Mm02_00312574 predicted 1675
8 SASI_Mm02_00312575 predicted 1824
9 SASI_Mm01_00059656 predicted 2615
10 SASI_Mm02_00312576 predicted 3234
11 SASI_Mm01_00059651 predicted 242
12 SASI_Mm01_00059653 predicted 1789
13 SASI_Mm01_00059657 predicted 2392
14 SASI_Mm01_00059658 predicted 3315
15 SASI_Mm01_00059659 predicted 3585
16 SASI_Mm01_00059660 predicted 1725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007835
DCTN1 MISSION shRNA Bacterial Glycerol Stock
dynactin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-2311s21c1
Sequence:CCGGAGTGCAGTGTGGACGTGTATACTCGAGTATACACGTCCACACTGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-3001s21c1
Sequence:CCGGCCATGCAAGAAGGCGAGTATGCTCGAGCATACTCGCCTTCTTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-3244s21c1
Sequence:CCGGCAGACGAGCGAATCGAGAAAGCTCGAGCTTTCTCGATTCGCTCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-1872s21c1
Sequence:CCGGGTCAATCGGGAGCTGACAAACCTCGAGGTTTGTCAGCTCCCGATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-2366s21c1
Sequence:CCGGCCACGAGCGCTCCTTAGATTTCTCGAGAAATCTAAGGAGCGCTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007835.1-3872s1c1
Sequence:CCGGCTTCCCTGCCTTCCCTGTGGTCTCGAGACCACAGGGAAGGCAGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-2401s1c1
Sequence:CCGGCCGTCAGTTCTGCAAGAAGATCTCGAGATCTTCTTGCAGAACTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-289s1c1
Sequence:CCGGCCAGTCCCAGATCCAAGTATTCTCGAGAATACTTGGATCTGGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-2348s1c1
Sequence:CCGGGCAACAGATATTGCCCTTCTTCTCGAGAAGAAGGGCAATATCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-1081s1c1
Sequence:CCGGCGCATCAAGCTACCAGCTCAACTCGAGTTGAGCTGGTAGCTTGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007835
DCTN1 MISSION shRNA shRNA Plasmid DNA
dynactin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-2311s21c1
Sequence:CCGGAGTGCAGTGTGGACGTGTATACTCGAGTATACACGTCCACACTGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-3001s21c1
Sequence:CCGGCCATGCAAGAAGGCGAGTATGCTCGAGCATACTCGCCTTCTTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-3244s21c1
Sequence:CCGGCAGACGAGCGAATCGAGAAAGCTCGAGCTTTCTCGATTCGCTCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-1872s21c1
Sequence:CCGGGTCAATCGGGAGCTGACAAACCTCGAGGTTTGTCAGCTCCCGATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-2366s21c1
Sequence:CCGGCCACGAGCGCTCCTTAGATTTCTCGAGAAATCTAAGGAGCGCTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007835.1-3872s1c1
Sequence:CCGGCTTCCCTGCCTTCCCTGTGGTCTCGAGACCACAGGGAAGGCAGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-2401s1c1
Sequence:CCGGCCGTCAGTTCTGCAAGAAGATCTCGAGATCTTCTTGCAGAACTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-289s1c1
Sequence:CCGGCCAGTCCCAGATCCAAGTATTCTCGAGAATACTTGGATCTGGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-2348s1c1
Sequence:CCGGGCAACAGATATTGCCCTTCTTCTCGAGAAGAAGGGCAATATCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-1081s1c1
Sequence:CCGGCGCATCAAGCTACCAGCTCAACTCGAGTTGAGCTGGTAGCTTGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007835
DCTN1 MISSION shRNA Lentiviral Transduction Particles
dynactin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-2311s21c1
Sequence:CCGGAGTGCAGTGTGGACGTGTATACTCGAGTATACACGTCCACACTGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-3001s21c1
Sequence:CCGGCCATGCAAGAAGGCGAGTATGCTCGAGCATACTCGCCTTCTTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-3244s21c1
Sequence:CCGGCAGACGAGCGAATCGAGAAAGCTCGAGCTTTCTCGATTCGCTCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-1872s21c1
Sequence:CCGGGTCAATCGGGAGCTGACAAACCTCGAGGTTTGTCAGCTCCCGATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007835.2-2366s21c1
Sequence:CCGGCCACGAGCGCTCCTTAGATTTCTCGAGAAATCTAAGGAGCGCTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007835.1-3872s1c1
Sequence:CCGGCTTCCCTGCCTTCCCTGTGGTCTCGAGACCACAGGGAAGGCAGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-2401s1c1
Sequence:CCGGCCGTCAGTTCTGCAAGAAGATCTCGAGATCTTCTTGCAGAACTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-289s1c1
Sequence:CCGGCCAGTCCCAGATCCAAGTATTCTCGAGAATACTTGGATCTGGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-2348s1c1
Sequence:CCGGGCAACAGATATTGCCCTTCTTCTCGAGAAGAAGGGCAATATCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007835.1-1081s1c1
Sequence:CCGGCGCATCAAGCTACCAGCTCAACTCGAGTTGAGCTGGTAGCTTGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004082
VALIDATED
DCTN1 MISSION shRNA Bacterial Glycerol Stock
dynactin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-1959s21c1
Sequence:CCGGCCAGAGACCTTTGACTTCAAACTCGAGTTTGAAGTCAAAGGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-2478s21c1
Sequence:CCGGGCCATCAAGTACTATCAGCATCTCGAGATGCTGATAGTACTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004082.3-3776s21c1
Sequence:CCGGGCTGGAGACATTGAATCAATTCTCGAGAATTGATTCAATGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-1884s21c1
Sequence:CCGGGCCCATCTACAGGATGTGAATCTCGAGATTCACATCCTGTAGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004082.3-2187s21c1
Sequence:CCGGGCCCAGGAGAAGTTTGAACTACTCGAGTAGTTCAAACTTCTCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2373s1c1
Sequence:CCGGGCCCATCTACAGGATGTGAATCTCGAGATTCACATCCTGTAGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-4265s1c1
Sequence:CCGGGCTGGAGACATTGAATCAATTCTCGAGAATTGATTCAATGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2448s1c1
Sequence:CCGGCCAGAGACCTTTGACTTCAAACTCGAGTTTGAAGTCAAAGGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2676s1c1
Sequence:CCGGGCCCAGGAGAAGTTTGAACTACTCGAGTAGTTCAAACTTCTCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2967s1c1
Sequence:CCGGGCCATCAAGTACTATCAGCATCTCGAGATGCTGATAGTACTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004082
VALIDATED
DCTN1 MISSION shRNA shRNA Plasmid DNA
dynactin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-1959s21c1
Sequence:CCGGCCAGAGACCTTTGACTTCAAACTCGAGTTTGAAGTCAAAGGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-2478s21c1
Sequence:CCGGGCCATCAAGTACTATCAGCATCTCGAGATGCTGATAGTACTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004082.3-3776s21c1
Sequence:CCGGGCTGGAGACATTGAATCAATTCTCGAGAATTGATTCAATGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-1884s21c1
Sequence:CCGGGCCCATCTACAGGATGTGAATCTCGAGATTCACATCCTGTAGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004082.3-2187s21c1
Sequence:CCGGGCCCAGGAGAAGTTTGAACTACTCGAGTAGTTCAAACTTCTCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2373s1c1
Sequence:CCGGGCCCATCTACAGGATGTGAATCTCGAGATTCACATCCTGTAGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-4265s1c1
Sequence:CCGGGCTGGAGACATTGAATCAATTCTCGAGAATTGATTCAATGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2448s1c1
Sequence:CCGGCCAGAGACCTTTGACTTCAAACTCGAGTTTGAAGTCAAAGGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2676s1c1
Sequence:CCGGGCCCAGGAGAAGTTTGAACTACTCGAGTAGTTCAAACTTCTCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2967s1c1
Sequence:CCGGGCCATCAAGTACTATCAGCATCTCGAGATGCTGATAGTACTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004082
VALIDATED
DCTN1 MISSION shRNA Lentiviral Transduction Particles
dynactin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-1959s21c1
Sequence:CCGGCCAGAGACCTTTGACTTCAAACTCGAGTTTGAAGTCAAAGGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-2478s21c1
Sequence:CCGGGCCATCAAGTACTATCAGCATCTCGAGATGCTGATAGTACTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004082.3-3776s21c1
Sequence:CCGGGCTGGAGACATTGAATCAATTCTCGAGAATTGATTCAATGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004082.3-1884s21c1
Sequence:CCGGGCCCATCTACAGGATGTGAATCTCGAGATTCACATCCTGTAGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004082.3-2187s21c1
Sequence:CCGGGCCCAGGAGAAGTTTGAACTACTCGAGTAGTTCAAACTTCTCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2373s1c1
Sequence:CCGGGCCCATCTACAGGATGTGAATCTCGAGATTCACATCCTGTAGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-4265s1c1
Sequence:CCGGGCTGGAGACATTGAATCAATTCTCGAGAATTGATTCAATGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2448s1c1
Sequence:CCGGCCAGAGACCTTTGACTTCAAACTCGAGTTTGAAGTCAAAGGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2676s1c1
Sequence:CCGGGCCCAGGAGAAGTTTGAACTACTCGAGTAGTTCAAACTTCTCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004082.2-2967s1c1
Sequence:CCGGGCCATCAAGTACTATCAGCATCTCGAGATGCTGATAGTACTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)