EMAIL THIS PAGE TO A FRIEND

DCTN2

dynactin 2 (p50)

96 Gene Product Result for
Synonyms: DCTN50 DYNAMITIN RBP50
UniProtKB ID: Q13561, B2RBK5, Q86YN2, Q9BW17
Gene ID:
Human(10540) Summary: This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(69654) dynactin 2
Rat(299850) dynactin 2 (p50)
Zebrafish(394141) dynactin 2 (p50)
cow(527201) dynactin 2 (p50)
Horse(100050464) dynactin 2 (p50)
domestic cat(101093950) dynactin 2 (p50)
dog(474415) dynactin 2 (p50)
chicken(395587) dynactin 2 (p50)
naked mole-rat(101713049) dynactin 2 (p50)
sheep(101119807) dynactin 2 (p50)
Domestic Rabbit(100339187) dynactin 2 (p50)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006400 Rosetta Predictions human pricing
NM_001004239 Rosetta Predictions rat pricing
NM_027151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051278 predicted 853
2 SASI_Hs01_00051279 predicted 279
3 SASI_Hs01_00051281 predicted 477
4 SASI_Hs01_00051282 predicted 336
5 SASI_Hs01_00051284 predicted 812
6 SASI_Hs01_00051285 predicted 1391
7 SASI_Hs02_00341475 predicted 672
8 SASI_Hs01_00051287 predicted 1210
9 SASI_Hs02_00341476 predicted 1262
10 SASI_Hs02_00341477 predicted 742
11 SASI_Hs01_00051280 predicted 549
12 SASI_Hs01_00051283 predicted 1031
13 SASI_Hs01_00051286 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066960 predicted 304
2 SASI_Rn01_00066961 predicted 887
3 SASI_Rn02_00198248 predicted 340
4 SASI_Rn01_00066962 predicted 1107
5 SASI_Rn01_00066963 predicted 1284
6 SASI_Rn01_00066964 predicted 898
7 SASI_Rn01_00066965 predicted 1021
8 SASI_Rn01_00066966 predicted 1107
9 SASI_Rn01_00066967 predicted 407
10 SASI_Rn01_00066969 predicted 1287
11 SASI_Rn01_00066968 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134870 predicted 291
2 SASI_Mm01_00134871 predicted 332
3 SASI_Mm01_00134872 predicted 327
4 SASI_Mm01_00134873 predicted 931
5 SASI_Mm01_00134874 predicted 755
6 SASI_Mm01_00134875 predicted 879
7 SASI_Mm01_00134876 predicted 1218
8 SASI_Mm01_00134877 predicted 1091
9 SASI_Mm01_00134878 predicted 1274
10 SASI_Mm02_00331658 predicted 623
11 SASI_Mm01_00134879 predicted 1190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027151
VALIDATED
DCTN2 MISSION shRNA Bacterial Glycerol Stock
dynactin 2 (p50)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027151.1-1348s1c1
Sequence:CCGGCCTGAACTTTGTCAGACCCTTCTCGAGAAGGGTCTGACAAAGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-298s1c1
Sequence:CCGGGCTTGATTTCTCAGATCGCATCTCGAGATGCGATCTGAGAAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-398s1c1
Sequence:CCGGCAGCAGAAGTACCAACGACTACTCGAGTAGTCGTTGGTACTTCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-1120s1c1
Sequence:CCGGGCATGAGCAAGCTATGCAGTTCTCGAGAACTGCATAGCTTGCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-299s1c1
Sequence:CCGGCTTGATTTCTCAGATCGCATTCTCGAGAATGCGATCTGAGAAATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-140s21c1
Sequence:CCGGAGGAATGAGCCAGACGTTTATCTCGAGATAAACGTCTGGCTCATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-1120s21c1
Sequence:CCGGGCATGAGCAAGCTATGCAGTTCTCGAGAACTGCATAGCTTGCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-1399s21c1
Sequence:CCGGTGACAAGGGCAAGGGTTCTTGCTCGAGCAAGAACCCTTGCCCTTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027151.1-298s21c1
Sequence:CCGGGCTTGATTTCTCAGATCGCATCTCGAGATGCGATCTGAGAAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-398s21c1
Sequence:CCGGCAGCAGAAGTACCAACGACTACTCGAGTAGTCGTTGGTACTTCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027151
VALIDATED
DCTN2 MISSION shRNA shRNA Plasmid DNA
dynactin 2 (p50)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027151.1-1348s1c1
Sequence:CCGGCCTGAACTTTGTCAGACCCTTCTCGAGAAGGGTCTGACAAAGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-298s1c1
Sequence:CCGGGCTTGATTTCTCAGATCGCATCTCGAGATGCGATCTGAGAAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-398s1c1
Sequence:CCGGCAGCAGAAGTACCAACGACTACTCGAGTAGTCGTTGGTACTTCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-1120s1c1
Sequence:CCGGGCATGAGCAAGCTATGCAGTTCTCGAGAACTGCATAGCTTGCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-299s1c1
Sequence:CCGGCTTGATTTCTCAGATCGCATTCTCGAGAATGCGATCTGAGAAATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-140s21c1
Sequence:CCGGAGGAATGAGCCAGACGTTTATCTCGAGATAAACGTCTGGCTCATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-1120s21c1
Sequence:CCGGGCATGAGCAAGCTATGCAGTTCTCGAGAACTGCATAGCTTGCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-1399s21c1
Sequence:CCGGTGACAAGGGCAAGGGTTCTTGCTCGAGCAAGAACCCTTGCCCTTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027151.1-298s21c1
Sequence:CCGGGCTTGATTTCTCAGATCGCATCTCGAGATGCGATCTGAGAAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-398s21c1
Sequence:CCGGCAGCAGAAGTACCAACGACTACTCGAGTAGTCGTTGGTACTTCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027151
VALIDATED
DCTN2 MISSION shRNA Lentiviral Transduction Particles
dynactin 2 (p50)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027151.1-1348s1c1
Sequence:CCGGCCTGAACTTTGTCAGACCCTTCTCGAGAAGGGTCTGACAAAGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-298s1c1
Sequence:CCGGGCTTGATTTCTCAGATCGCATCTCGAGATGCGATCTGAGAAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-398s1c1
Sequence:CCGGCAGCAGAAGTACCAACGACTACTCGAGTAGTCGTTGGTACTTCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-1120s1c1
Sequence:CCGGGCATGAGCAAGCTATGCAGTTCTCGAGAACTGCATAGCTTGCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027151.1-299s1c1
Sequence:CCGGCTTGATTTCTCAGATCGCATTCTCGAGAATGCGATCTGAGAAATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-140s21c1
Sequence:CCGGAGGAATGAGCCAGACGTTTATCTCGAGATAAACGTCTGGCTCATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-1120s21c1
Sequence:CCGGGCATGAGCAAGCTATGCAGTTCTCGAGAACTGCATAGCTTGCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-1399s21c1
Sequence:CCGGTGACAAGGGCAAGGGTTCTTGCTCGAGCAAGAACCCTTGCCCTTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027151.1-298s21c1
Sequence:CCGGGCTTGATTTCTCAGATCGCATCTCGAGATGCGATCTGAGAAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027151.1-398s21c1
Sequence:CCGGCAGCAGAAGTACCAACGACTACTCGAGTAGTCGTTGGTACTTCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006400
VALIDATED
DCTN2 MISSION shRNA Bacterial Glycerol Stock
dynactin 2 (p50)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1218s1c1
Sequence:CCGGGCAGATGATTGCTAATTCCTTCTCGAGAAGGAATTAGCAATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1510s1c1
Sequence:CCGGCCTGATGAATACAGAGTGGTACTCGAGTACCACTCTGTATTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006400.3-170s1c1
Sequence:CCGGCCAGGAATGAGCCAGATGTTTCTCGAGAAACATCTGGCTCATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-382s1c1
Sequence:CCGGACAGGATATGAATCTGGAGAACTCGAGTTCTCCAGATTCATATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1039s1c1
Sequence:CCGGGCCTCTGTAGAAGATGCAGATCTCGAGATCTGCATCTTCTACAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006400.3-280s21c1
Sequence:CCGGCACATCATTGTCAATCCTAATCTCGAGATTAGGATTGACAATGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1399s21c1
Sequence:CCGGACTCTGTTAACAGCTTACATACTCGAGTATGTAAGCTGTTAACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1067s21c1
Sequence:CCGGGCAAGGTGCACCAGCTATATGCTCGAGCATATAGCTGGTGCACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1019s21c1
Sequence:CCGGACGAGATTGCCAAGCATAAAGCTCGAGCTTTATGCTTGGCAATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006400.3-748s21c1
Sequence:CCGGGATAGCAGCCTTGTCACTTATCTCGAGATAAGTGACAAGGCTGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006400
VALIDATED
DCTN2 MISSION shRNA shRNA Plasmid DNA
dynactin 2 (p50)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1218s1c1
Sequence:CCGGGCAGATGATTGCTAATTCCTTCTCGAGAAGGAATTAGCAATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1510s1c1
Sequence:CCGGCCTGATGAATACAGAGTGGTACTCGAGTACCACTCTGTATTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006400.3-170s1c1
Sequence:CCGGCCAGGAATGAGCCAGATGTTTCTCGAGAAACATCTGGCTCATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-382s1c1
Sequence:CCGGACAGGATATGAATCTGGAGAACTCGAGTTCTCCAGATTCATATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1039s1c1
Sequence:CCGGGCCTCTGTAGAAGATGCAGATCTCGAGATCTGCATCTTCTACAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006400.3-280s21c1
Sequence:CCGGCACATCATTGTCAATCCTAATCTCGAGATTAGGATTGACAATGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1399s21c1
Sequence:CCGGACTCTGTTAACAGCTTACATACTCGAGTATGTAAGCTGTTAACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1067s21c1
Sequence:CCGGGCAAGGTGCACCAGCTATATGCTCGAGCATATAGCTGGTGCACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1019s21c1
Sequence:CCGGACGAGATTGCCAAGCATAAAGCTCGAGCTTTATGCTTGGCAATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006400.3-748s21c1
Sequence:CCGGGATAGCAGCCTTGTCACTTATCTCGAGATAAGTGACAAGGCTGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006400
VALIDATED
DCTN2 MISSION shRNA Lentiviral Transduction Particles
dynactin 2 (p50)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1218s1c1
Sequence:CCGGGCAGATGATTGCTAATTCCTTCTCGAGAAGGAATTAGCAATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1510s1c1
Sequence:CCGGCCTGATGAATACAGAGTGGTACTCGAGTACCACTCTGTATTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006400.3-170s1c1
Sequence:CCGGCCAGGAATGAGCCAGATGTTTCTCGAGAAACATCTGGCTCATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-382s1c1
Sequence:CCGGACAGGATATGAATCTGGAGAACTCGAGTTCTCCAGATTCATATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006400.3-1039s1c1
Sequence:CCGGGCCTCTGTAGAAGATGCAGATCTCGAGATCTGCATCTTCTACAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006400.3-280s21c1
Sequence:CCGGCACATCATTGTCAATCCTAATCTCGAGATTAGGATTGACAATGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1399s21c1
Sequence:CCGGACTCTGTTAACAGCTTACATACTCGAGTATGTAAGCTGTTAACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1067s21c1
Sequence:CCGGGCAAGGTGCACCAGCTATATGCTCGAGCATATAGCTGGTGCACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006400.3-1019s21c1
Sequence:CCGGACGAGATTGCCAAGCATAAAGCTCGAGCTTTATGCTTGGCAATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006400.3-748s21c1
Sequence:CCGGGATAGCAGCCTTGTCACTTATCTCGAGATAAGTGACAAGGCTGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)