EMAIL THIS PAGE TO A FRIEND

DCTN3

dynactin 3 (p22)

79 Gene Product Result for
Synonyms: DCTN-22 DCTN22
Gene ID:
Human(11258) Summary: This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(53598) dynactin 3
Rat(362504) dynactin 3
sheep(101121236) dynactin 3 (p22)
naked mole-rat(101706314) dynactin 3 (p22)
Zebrafish(431767) dynactin 3 (p22)
chicken(427404) dynactin 3 (p22)
cow(514327) dynactin 3 (p22)
domestic cat(101083978) dynactin 3 (p22)
dog(474750) dynactin 3 (p22)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007234 Rosetta Predictions human pricing
NM_024348 Rosetta Predictions human pricing
NM_001108659 Rosetta Predictions rat pricing
NM_016890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238325 predicted 444
2 SASI_Hs01_00238326 predicted 542
3 SASI_Hs02_00343238 predicted 502
4 SASI_Hs01_00238327 predicted 547
5 SASI_Hs01_00238328 predicted 499
6 SASI_Hs01_00238329 predicted 370
7 SASI_Hs01_00238330 predicted 359
8 SASI_Hs01_00238331 predicted 358
9 SASI_Hs01_00238332 predicted 522
10 SASI_Hs02_00343239 predicted 379
11 SASI_Hs01_00238333 predicted 470
12 SASI_Hs01_00238334 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131869 predicted 514
2 SASI_Hs02_00356705 predicted 543
3 SASI_Hs02_00356706 predicted 461
4 SASI_Hs01_00131872 predicted 651
5 SASI_Hs01_00131873 predicted 603
6 SASI_Hs01_00131874 predicted 364
7 SASI_Hs01_00131875 predicted 359
8 SASI_Hs01_00131876 predicted 522
9 SASI_Hs01_00131877 predicted 359
10 SASI_Hs01_00131878 predicted 616
11 SASI_Hs01_00131870 predicted 513
12 SASI_Hs01_00131871 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240809 predicted 629
2 SASI_Rn02_00240810 predicted 735
3 SASI_Rn02_00240811 predicted 724
4 SASI_Rn02_00240812 predicted 724
5 SASI_Rn02_00240813 predicted 742
6 SASI_Rn02_00240814 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059414 predicted 443
2 SASI_Mm01_00059415 predicted 544
3 SASI_Mm01_00059416 predicted 226
4 SASI_Mm01_00059417 predicted 680
5 SASI_Mm01_00059418 predicted 735
6 SASI_Mm01_00059419 predicted 695
7 SASI_Mm01_00059420 predicted 230
8 SASI_Mm02_00323722 predicted 438
9 SASI_Mm01_00059422 predicted 264
10 SASI_Mm01_00059423 predicted 635
11 SASI_Mm01_00059421 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016890
VALIDATED
DCTN3 MISSION shRNA Bacterial Glycerol Stock
dynactin 3 (p22)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-457s21c1
Sequence:CCGGGCGATCACTGAAGAGTCTAAGCTCGAGCTTAGACTCTTCAGTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-212s21c1
Sequence:CCGGAGATTGAAGACCTGATTAAATCTCGAGATTTAATCAGGTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-489s21c1
Sequence:CCGGAGGGTATAACAAGACTACAATCTCGAGATTGTAGTCTTGTTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016890.4-370s21c1
Sequence:CCGGAGCGCTTCTATCAAAGCTGTTCTCGAGAACAGCTTTGATAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-645s21c1
Sequence:CCGGCGCACCAACCTGTCTCTATAACTCGAGTTATAGAGACAGGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-240s21c1
Sequence:CCGGTCCTGAGTACATTGATCGCATCTCGAGATGCGATCAATGTACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-642s1c1
Sequence:CCGGCGCACCAACCTGTCTCTATAACTCGAGTTATAGAGACAGGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-486s1c1
Sequence:CCGGAGGGTATAACAAGACTACAATCTCGAGATTGTAGTCTTGTTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-367s1c1
Sequence:CCGGAGCGCTTCTATCAAAGCTGTTCTCGAGAACAGCTTTGATAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-237s1c1
Sequence:CCGGTCCTGAGTACATTGATCGCATCTCGAGATGCGATCAATGTACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-238s1c1
Sequence:CCGGCCTGAGTACATTGATCGCATTCTCGAGAATGCGATCAATGTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016890
VALIDATED
DCTN3 MISSION shRNA shRNA Plasmid DNA
dynactin 3 (p22)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-457s21c1
Sequence:CCGGGCGATCACTGAAGAGTCTAAGCTCGAGCTTAGACTCTTCAGTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-212s21c1
Sequence:CCGGAGATTGAAGACCTGATTAAATCTCGAGATTTAATCAGGTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-489s21c1
Sequence:CCGGAGGGTATAACAAGACTACAATCTCGAGATTGTAGTCTTGTTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016890.4-370s21c1
Sequence:CCGGAGCGCTTCTATCAAAGCTGTTCTCGAGAACAGCTTTGATAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-645s21c1
Sequence:CCGGCGCACCAACCTGTCTCTATAACTCGAGTTATAGAGACAGGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-240s21c1
Sequence:CCGGTCCTGAGTACATTGATCGCATCTCGAGATGCGATCAATGTACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-642s1c1
Sequence:CCGGCGCACCAACCTGTCTCTATAACTCGAGTTATAGAGACAGGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-486s1c1
Sequence:CCGGAGGGTATAACAAGACTACAATCTCGAGATTGTAGTCTTGTTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-367s1c1
Sequence:CCGGAGCGCTTCTATCAAAGCTGTTCTCGAGAACAGCTTTGATAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-237s1c1
Sequence:CCGGTCCTGAGTACATTGATCGCATCTCGAGATGCGATCAATGTACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-238s1c1
Sequence:CCGGCCTGAGTACATTGATCGCATTCTCGAGAATGCGATCAATGTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016890
VALIDATED
DCTN3 MISSION shRNA Lentiviral Transduction Particles
dynactin 3 (p22)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-457s21c1
Sequence:CCGGGCGATCACTGAAGAGTCTAAGCTCGAGCTTAGACTCTTCAGTGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-212s21c1
Sequence:CCGGAGATTGAAGACCTGATTAAATCTCGAGATTTAATCAGGTCTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-489s21c1
Sequence:CCGGAGGGTATAACAAGACTACAATCTCGAGATTGTAGTCTTGTTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016890.4-370s21c1
Sequence:CCGGAGCGCTTCTATCAAAGCTGTTCTCGAGAACAGCTTTGATAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-645s21c1
Sequence:CCGGCGCACCAACCTGTCTCTATAACTCGAGTTATAGAGACAGGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016890.4-240s21c1
Sequence:CCGGTCCTGAGTACATTGATCGCATCTCGAGATGCGATCAATGTACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-642s1c1
Sequence:CCGGCGCACCAACCTGTCTCTATAACTCGAGTTATAGAGACAGGTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-486s1c1
Sequence:CCGGAGGGTATAACAAGACTACAATCTCGAGATTGTAGTCTTGTTATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-367s1c1
Sequence:CCGGAGCGCTTCTATCAAAGCTGTTCTCGAGAACAGCTTTGATAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-237s1c1
Sequence:CCGGTCCTGAGTACATTGATCGCATCTCGAGATGCGATCAATGTACTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016890.2-238s1c1
Sequence:CCGGCCTGAGTACATTGATCGCATTCTCGAGAATGCGATCAATGTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007234
VALIDATED
DCTN3 MISSION shRNA Bacterial Glycerol Stock
dynactin 3 (p22)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-508s21c1
Sequence:CCGGCAATGCTTCTCTCCAAGCAATCTCGAGATTGCTTGGAGAGAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-443s21c1
Sequence:CCGGGCAGGACCAGTGTGTGGAAATCTCGAGATTTCCACACACTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-222s21c1
Sequence:CCGGGATCTGATCAAGTACCTGGATCTCGAGATCCAGGTACTTGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-272s21c1
Sequence:CCGGTGATGCCTCTAAGCTGCAATTCTCGAGAATTGCAGCTTAGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007234.3-660s21c1
Sequence:CCGGCTTTGTTACAAGGCAGAGGAACTCGAGTTCCTCTGCCTTGTAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007234.3-660s1c1
Sequence:CCGGCTTTGTTACAAGGCAGAGGAACTCGAGTTCCTCTGCCTTGTAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-443s1c1
Sequence:CCGGGCAGGACCAGTGTGTGGAAATCTCGAGATTTCCACACACTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-222s1c1
Sequence:CCGGGATCTGATCAAGTACCTGGATCTCGAGATCCAGGTACTTGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-272s1c1
Sequence:CCGGTGATGCCTCTAAGCTGCAATTCTCGAGAATTGCAGCTTAGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-508s1c1
Sequence:CCGGCAATGCTTCTCTCCAAGCAATCTCGAGATTGCTTGGAGAGAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007234
VALIDATED
DCTN3 MISSION shRNA shRNA Plasmid DNA
dynactin 3 (p22)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-508s21c1
Sequence:CCGGCAATGCTTCTCTCCAAGCAATCTCGAGATTGCTTGGAGAGAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-443s21c1
Sequence:CCGGGCAGGACCAGTGTGTGGAAATCTCGAGATTTCCACACACTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-222s21c1
Sequence:CCGGGATCTGATCAAGTACCTGGATCTCGAGATCCAGGTACTTGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-272s21c1
Sequence:CCGGTGATGCCTCTAAGCTGCAATTCTCGAGAATTGCAGCTTAGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007234.3-660s21c1
Sequence:CCGGCTTTGTTACAAGGCAGAGGAACTCGAGTTCCTCTGCCTTGTAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007234.3-660s1c1
Sequence:CCGGCTTTGTTACAAGGCAGAGGAACTCGAGTTCCTCTGCCTTGTAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-443s1c1
Sequence:CCGGGCAGGACCAGTGTGTGGAAATCTCGAGATTTCCACACACTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-222s1c1
Sequence:CCGGGATCTGATCAAGTACCTGGATCTCGAGATCCAGGTACTTGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-272s1c1
Sequence:CCGGTGATGCCTCTAAGCTGCAATTCTCGAGAATTGCAGCTTAGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-508s1c1
Sequence:CCGGCAATGCTTCTCTCCAAGCAATCTCGAGATTGCTTGGAGAGAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007234
VALIDATED
DCTN3 MISSION shRNA Lentiviral Transduction Particles
dynactin 3 (p22)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-508s21c1
Sequence:CCGGCAATGCTTCTCTCCAAGCAATCTCGAGATTGCTTGGAGAGAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-443s21c1
Sequence:CCGGGCAGGACCAGTGTGTGGAAATCTCGAGATTTCCACACACTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-222s21c1
Sequence:CCGGGATCTGATCAAGTACCTGGATCTCGAGATCCAGGTACTTGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007234.3-272s21c1
Sequence:CCGGTGATGCCTCTAAGCTGCAATTCTCGAGAATTGCAGCTTAGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007234.3-660s21c1
Sequence:CCGGCTTTGTTACAAGGCAGAGGAACTCGAGTTCCTCTGCCTTGTAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007234.3-660s1c1
Sequence:CCGGCTTTGTTACAAGGCAGAGGAACTCGAGTTCCTCTGCCTTGTAACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-443s1c1
Sequence:CCGGGCAGGACCAGTGTGTGGAAATCTCGAGATTTCCACACACTGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-222s1c1
Sequence:CCGGGATCTGATCAAGTACCTGGATCTCGAGATCCAGGTACTTGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-272s1c1
Sequence:CCGGTGATGCCTCTAAGCTGCAATTCTCGAGAATTGCAGCTTAGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007234.3-508s1c1
Sequence:CCGGCAATGCTTCTCTCCAAGCAATCTCGAGATTGCTTGGAGAGAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks