EMAIL THIS PAGE TO A FRIEND

DCTN4

dynactin 4 (p62)

140 Gene Product Result for
Synonyms: DYN4 P62
UniProtKB ID: Q9UJW0, B3KWW0, D3DQH0, E5RGT5, Q8TAN8
Gene ID:
Mouse(67665) dynactin 4
Rat(84428) dynactin 4 (p62)
naked mole-rat(101697514) dynactin 4 (p62)
sheep(101103473) dynactin 4 (p62)
Domestic Rabbit(100345319) dynactin 4 (p62)
Zebrafish(550479) dynactin 4
cow(613489) dynactin 4 (p62)
Horse(100071625) dynactin 4 (p62)
domestic cat(101082211) dynactin 4 (p62)
chicken(416269) dynactin 4 (p62)
dog(479326) dynactin 4 (p62)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016221 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016221 Rosetta Predictions human pricing
NM_053404 Rosetta Predictions rat pricing
NM_026302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112054 predicted 801
2 SASI_Hs01_00112055 predicted 809
3 SASI_Hs01_00112056 predicted 1064
4 SASI_Hs01_00112057 predicted 1023
5 SASI_Hs01_00112058 predicted 217
6 SASI_Hs01_00112059 predicted 1269
7 SASI_Hs02_00349079 predicted 875
8 SASI_Hs01_00112060 predicted 511
9 SASI_Hs01_00112061 predicted 1002
10 SASI_Hs01_00112062 predicted 955
11 SASI_Hs01_00112063 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069367 predicted 314
2 SASI_Rn02_00265907 predicted 907
3 SASI_Rn02_00265908 predicted 1171
4 SASI_Rn01_00069368 predicted 727
5 SASI_Rn01_00069369 predicted 424
6 SASI_Rn02_00265909 predicted 419
7 SASI_Rn02_00265910 predicted 1094
8 SASI_Rn02_00265911 predicted 1105
9 SASI_Rn01_00069374 predicted 346
10 SASI_Rn02_00265912 predicted 409
11 SASI_Rn01_00069370 predicted 602
12 SASI_Rn01_00069371 predicted 1500
13 SASI_Rn01_00069372 predicted 992
14 SASI_Rn01_00069373 predicted 948
15 SASI_Rn01_00069375 predicted 1506
16 SASI_Rn01_00069376 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112084 predicted 429
2 SASI_Mm01_00112085 predicted 747
3 SASI_Mm01_00112086 predicted 1018
4 SASI_Mm01_00112087 predicted 358
5 SASI_Mm01_00112088 predicted 1261
6 SASI_Mm01_00112089 predicted 1195
7 SASI_Mm01_00112090 predicted 912
8 SASI_Mm01_00112091 predicted 922
9 SASI_Mm01_00112092 predicted 795
10 SASI_Mm01_00112093 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026302
VALIDATED
DCTN4 MISSION shRNA Bacterial Glycerol Stock
dynactin 4 (p62)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-2647s1c1
Sequence:CCGGCCTGCTTACAAACCCTGCTTTCTCGAGAAAGCAGGGTTTGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-517s1c1
Sequence:CCGGGCGAAGAAATTACATGCCTTTCTCGAGAAAGGCATGTAATTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-1263s1c1
Sequence:CCGGGCTTCAAGATGAAACACGATTCTCGAGAATCGTGTTTCATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-434s1c1
Sequence:CCGGCAACGGATGAACAAGTTGATTCTCGAGAATCAACTTGTTCATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026302.2-1091s1c1
Sequence:CCGGCCTCCCAAAGAGCTCATCTTACTCGAGTAAGATGAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-907s21c1
Sequence:CCGGGTTGGTTGCTGTCAATTATATCTCGAGATATAATTGACAGCAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-517s21c1
Sequence:CCGGGCGAAGAAATTACATGCCTTTCTCGAGAAAGGCATGTAATTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-434s21c1
Sequence:CCGGCAACGGATGAACAAGTTGATTCTCGAGAATCAACTTGTTCATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-1263s21c1
Sequence:CCGGGCTTCAAGATGAAACACGATTCTCGAGAATCGTGTTTCATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-1449s21c1
Sequence:CCGGTGCTTCACCAGTCGTGTTTATCTCGAGATAAACACGACTGGTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026302
VALIDATED
DCTN4 MISSION shRNA shRNA Plasmid DNA
dynactin 4 (p62)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-2647s1c1
Sequence:CCGGCCTGCTTACAAACCCTGCTTTCTCGAGAAAGCAGGGTTTGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-517s1c1
Sequence:CCGGGCGAAGAAATTACATGCCTTTCTCGAGAAAGGCATGTAATTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-1263s1c1
Sequence:CCGGGCTTCAAGATGAAACACGATTCTCGAGAATCGTGTTTCATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-434s1c1
Sequence:CCGGCAACGGATGAACAAGTTGATTCTCGAGAATCAACTTGTTCATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026302.2-1091s1c1
Sequence:CCGGCCTCCCAAAGAGCTCATCTTACTCGAGTAAGATGAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-907s21c1
Sequence:CCGGGTTGGTTGCTGTCAATTATATCTCGAGATATAATTGACAGCAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-517s21c1
Sequence:CCGGGCGAAGAAATTACATGCCTTTCTCGAGAAAGGCATGTAATTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-434s21c1
Sequence:CCGGCAACGGATGAACAAGTTGATTCTCGAGAATCAACTTGTTCATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-1263s21c1
Sequence:CCGGGCTTCAAGATGAAACACGATTCTCGAGAATCGTGTTTCATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-1449s21c1
Sequence:CCGGTGCTTCACCAGTCGTGTTTATCTCGAGATAAACACGACTGGTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026302
VALIDATED
DCTN4 MISSION shRNA Lentiviral Transduction Particles
dynactin 4 (p62)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-2647s1c1
Sequence:CCGGCCTGCTTACAAACCCTGCTTTCTCGAGAAAGCAGGGTTTGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-517s1c1
Sequence:CCGGGCGAAGAAATTACATGCCTTTCTCGAGAAAGGCATGTAATTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-1263s1c1
Sequence:CCGGGCTTCAAGATGAAACACGATTCTCGAGAATCGTGTTTCATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026302.2-434s1c1
Sequence:CCGGCAACGGATGAACAAGTTGATTCTCGAGAATCAACTTGTTCATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026302.2-1091s1c1
Sequence:CCGGCCTCCCAAAGAGCTCATCTTACTCGAGTAAGATGAGCTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-907s21c1
Sequence:CCGGGTTGGTTGCTGTCAATTATATCTCGAGATATAATTGACAGCAACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-517s21c1
Sequence:CCGGGCGAAGAAATTACATGCCTTTCTCGAGAAAGGCATGTAATTTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-434s21c1
Sequence:CCGGCAACGGATGAACAAGTTGATTCTCGAGAATCAACTTGTTCATCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-1263s21c1
Sequence:CCGGGCTTCAAGATGAAACACGATTCTCGAGAATCGTGTTTCATCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026302.3-1449s21c1
Sequence:CCGGTGCTTCACCAGTCGTGTTTATCTCGAGATAAACACGACTGGTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016221
VALIDATED
DCTN4 MISSION shRNA Bacterial Glycerol Stock
dynactin 4 (p62)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016221.2-164s1c1
Sequence:CCGGCCCATTATTGTCCCAGTTGTTCTCGAGAACAACTGGGACAATAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016221.2-925s1c1
Sequence:CCGGGCTGTCAATTATATTCCAGAACTCGAGTTCTGGAATATAATTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016221.2-2009s1c1
Sequence:CCGGGCACTCTCATTTGCCCTCTTTCTCGAGAAAGAGGGCAAATGAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016221.2-851s1c1
Sequence:CCGGGCCGTAAATGTGAACATAATTCTCGAGAATTATGTTCACATTTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016221.2-1198s1c1
Sequence:CCGGGCCTTCAGAAAGGCCAACAAACTCGAGTTTGTTGGCCTTTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-1441s21c1
Sequence:CCGGTCACCGTAAACCTGCGTTAAACTCGAGTTTAACGCAGGTTTACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-918s21c1
Sequence:CCGGGCTGGTCGCTGTCAATTATATCTCGAGATATAATTGACAGCGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-198s21c1
Sequence:CCGGATCGGCTGAAGCCAAACTAAACTCGAGTTTAGTTTGGCTTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-700s21c1
Sequence:CCGGCCTCTACCTGAAGACTATTATCTCGAGATAATAGTCTTCAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-620s21c1
Sequence:CCGGTTGCCGGACTTTCCCTTAAAGCTCGAGCTTTAAGGGAAAGTCCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016221
VALIDATED
DCTN4 MISSION shRNA shRNA Plasmid DNA
dynactin 4 (p62)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016221.2-164s1c1
Sequence:CCGGCCCATTATTGTCCCAGTTGTTCTCGAGAACAACTGGGACAATAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016221.2-925s1c1
Sequence:CCGGGCTGTCAATTATATTCCAGAACTCGAGTTCTGGAATATAATTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016221.2-2009s1c1
Sequence:CCGGGCACTCTCATTTGCCCTCTTTCTCGAGAAAGAGGGCAAATGAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016221.2-851s1c1
Sequence:CCGGGCCGTAAATGTGAACATAATTCTCGAGAATTATGTTCACATTTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016221.2-1198s1c1
Sequence:CCGGGCCTTCAGAAAGGCCAACAAACTCGAGTTTGTTGGCCTTTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-1441s21c1
Sequence:CCGGTCACCGTAAACCTGCGTTAAACTCGAGTTTAACGCAGGTTTACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-918s21c1
Sequence:CCGGGCTGGTCGCTGTCAATTATATCTCGAGATATAATTGACAGCGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-198s21c1
Sequence:CCGGATCGGCTGAAGCCAAACTAAACTCGAGTTTAGTTTGGCTTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-700s21c1
Sequence:CCGGCCTCTACCTGAAGACTATTATCTCGAGATAATAGTCTTCAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-620s21c1
Sequence:CCGGTTGCCGGACTTTCCCTTAAAGCTCGAGCTTTAAGGGAAAGTCCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016221
VALIDATED
DCTN4 MISSION shRNA Lentiviral Transduction Particles
dynactin 4 (p62)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016221.2-164s1c1
Sequence:CCGGCCCATTATTGTCCCAGTTGTTCTCGAGAACAACTGGGACAATAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016221.2-925s1c1
Sequence:CCGGGCTGTCAATTATATTCCAGAACTCGAGTTCTGGAATATAATTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016221.2-2009s1c1
Sequence:CCGGGCACTCTCATTTGCCCTCTTTCTCGAGAAAGAGGGCAAATGAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016221.2-851s1c1
Sequence:CCGGGCCGTAAATGTGAACATAATTCTCGAGAATTATGTTCACATTTACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016221.2-1198s1c1
Sequence:CCGGGCCTTCAGAAAGGCCAACAAACTCGAGTTTGTTGGCCTTTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-1441s21c1
Sequence:CCGGTCACCGTAAACCTGCGTTAAACTCGAGTTTAACGCAGGTTTACGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-918s21c1
Sequence:CCGGGCTGGTCGCTGTCAATTATATCTCGAGATATAATTGACAGCGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-198s21c1
Sequence:CCGGATCGGCTGAAGCCAAACTAAACTCGAGTTTAGTTTGGCTTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-700s21c1
Sequence:CCGGCCTCTACCTGAAGACTATTATCTCGAGATAATAGTCTTCAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016221.2-620s21c1
Sequence:CCGGTTGCCGGACTTTCCCTTAAAGCTCGAGCTTTAAGGGAAAGTCCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks