EMAIL THIS PAGE TO A FRIEND

DCTN5

dynactin 5 (p25)

142 Gene Product Result for
UniProtKB ID: Q9BTE1, A8K9X8, H3BN51, H3BQA4
Gene ID:
Human(84516) Summary: This gene encodes a subunit of dynactin, a component of the cytoplasmic dynein motor machinery involved in minus-end-directed transport. The encoded protein is a component of the pointed-end subcomplex and is thought to bind membranous cargo. A pseudogene of this gene is located on the long arm of chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(59288) dynactin 5
Rat(308961) dynactin 5 (p25)
Zebrafish(436770) dynactin 5
chicken(416574) dynactin 5 (p25)
dog(479804) dynactin 5 (p25)
cow(506441) dynactin 5 (p25)
domestic cat(101098762) dynactin 5 (p25)
sheep(101105464) dynactin 5 (p25)
naked mole-rat(101720702) dynactin 5 (p25)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032486 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032486 Rosetta Predictions human pricing
NM_001037778 Rosetta Predictions rat pricing
NM_021608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137361 predicted 818
2 SASI_Hs01_00137362 predicted 829
3 SASI_Hs01_00137363 predicted 256
4 SASI_Hs02_00359945 predicted 755
5 SASI_Hs01_00137364 predicted 363
6 SASI_Hs02_00359946 predicted 249
7 SASI_Hs01_00137367 predicted 868
8 SASI_Hs01_00137368 predicted 811
9 SASI_Hs01_00137369 predicted 821
10 SASI_Hs01_00137370 predicted 269
11 SASI_Hs01_00137365 predicted 762
12 SASI_Hs01_00137366 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093859 predicted 353
2 SASI_Rn01_00093860 predicted 278
3 SASI_Rn01_00093861 predicted 1089
4 SASI_Rn01_00093862 predicted 1047
5 SASI_Rn01_00093863 predicted 1021
6 SASI_Rn01_00093865 predicted 1055
7 SASI_Rn01_00093866 predicted 1091
8 SASI_Rn01_00093867 predicted 213
9 SASI_Rn01_00093868 predicted 241
10 SASI_Rn02_00204573 predicted 1073
11 SASI_Rn01_00093864 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326375 predicted 430
2 SASI_Mm01_00120928 predicted 445
3 SASI_Mm02_00326376 predicted 995
4 SASI_Mm01_00120929 predicted 991
5 SASI_Mm02_00326377 predicted 260
6 SASI_Mm02_00326378 predicted 1041
7 SASI_Mm01_00120931 predicted 993
8 SASI_Mm01_00120932 predicted 1044
9 SASI_Mm01_00120933 predicted 1029
10 SASI_Mm01_00120936 predicted 234
11 SASI_Mm01_00120927 predicted 261
12 SASI_Mm01_00120930 predicted 261
13 SASI_Mm01_00120934 predicted 377
14 SASI_Mm01_00120935 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021608
VALIDATED
DCTN5 MISSION shRNA Bacterial Glycerol Stock
dynactin 5 (p25)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-184s21c1
Sequence:CCGGAGCCAGAACATCGTCCTCAATCTCGAGATTGAGGACGATGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-244s21c1
Sequence:CCGGGACCTGGCAAATGTAAGAGTTCTCGAGAACTCTTACATTTGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021608.3-1226s21c1
Sequence:CCGGGCTGCTAAGATGGGACCAATACTCGAGTATTGGTCCCATCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-604s21c1
Sequence:CCGGAGCTACTACCAGAAGTTTCTACTCGAGTAGAAACTTCTGGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021608.2-1196s1c1
Sequence:CCGGGCTGCTAAGATGGGACCAATACTCGAGTATTGGTCCCATCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-213s1c1
Sequence:CCGGGACCTGGCAAATGTAAGAGTTCTCGAGAACTCTTACATTTGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-165s1c1
Sequence:CCGGGTCCTCAATGGCAAGACCATTCTCGAGAATGGTCTTGCCATTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-573s1c1
Sequence:CCGGAGCTACTACCAGAAGTTTCTACTCGAGTAGAAACTTCTGGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-153s1c1
Sequence:CCGGAGCCAGAACATCGTCCTCAATCTCGAGATTGAGGACGATGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021608
VALIDATED
DCTN5 MISSION shRNA shRNA Plasmid DNA
dynactin 5 (p25)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-184s21c1
Sequence:CCGGAGCCAGAACATCGTCCTCAATCTCGAGATTGAGGACGATGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-244s21c1
Sequence:CCGGGACCTGGCAAATGTAAGAGTTCTCGAGAACTCTTACATTTGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021608.3-1226s21c1
Sequence:CCGGGCTGCTAAGATGGGACCAATACTCGAGTATTGGTCCCATCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-604s21c1
Sequence:CCGGAGCTACTACCAGAAGTTTCTACTCGAGTAGAAACTTCTGGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021608.2-1196s1c1
Sequence:CCGGGCTGCTAAGATGGGACCAATACTCGAGTATTGGTCCCATCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-213s1c1
Sequence:CCGGGACCTGGCAAATGTAAGAGTTCTCGAGAACTCTTACATTTGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-165s1c1
Sequence:CCGGGTCCTCAATGGCAAGACCATTCTCGAGAATGGTCTTGCCATTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-573s1c1
Sequence:CCGGAGCTACTACCAGAAGTTTCTACTCGAGTAGAAACTTCTGGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-153s1c1
Sequence:CCGGAGCCAGAACATCGTCCTCAATCTCGAGATTGAGGACGATGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021608
VALIDATED
DCTN5 MISSION shRNA Lentiviral Transduction Particles
dynactin 5 (p25)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-184s21c1
Sequence:CCGGAGCCAGAACATCGTCCTCAATCTCGAGATTGAGGACGATGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-244s21c1
Sequence:CCGGGACCTGGCAAATGTAAGAGTTCTCGAGAACTCTTACATTTGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021608.3-1226s21c1
Sequence:CCGGGCTGCTAAGATGGGACCAATACTCGAGTATTGGTCCCATCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021608.3-604s21c1
Sequence:CCGGAGCTACTACCAGAAGTTTCTACTCGAGTAGAAACTTCTGGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021608.2-1196s1c1
Sequence:CCGGGCTGCTAAGATGGGACCAATACTCGAGTATTGGTCCCATCTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-213s1c1
Sequence:CCGGGACCTGGCAAATGTAAGAGTTCTCGAGAACTCTTACATTTGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-165s1c1
Sequence:CCGGGTCCTCAATGGCAAGACCATTCTCGAGAATGGTCTTGCCATTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-573s1c1
Sequence:CCGGAGCTACTACCAGAAGTTTCTACTCGAGTAGAAACTTCTGGTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021608.2-153s1c1
Sequence:CCGGAGCCAGAACATCGTCCTCAATCTCGAGATTGAGGACGATGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032486
VALIDATED
DCTN5 MISSION shRNA Bacterial Glycerol Stock
dynactin 5 (p25)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-418s21c1
Sequence:CCGGGTGTTGAAAGACTGCTGCAAACTCGAGTTTGCAGCAGTCTTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032486.2-842s21c1
Sequence:CCGGACAGTCACTTTGTACCATTATCTCGAGATAATGGTACAAAGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-181s21c1
Sequence:CCGGGTGATGAATGACTGTATTATCCTCGAGGATAATACAGTCATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-219s21c1
Sequence:CCGGTGTAAGAGTTGGACGTCATTGCTCGAGCAATGACGTCCAACTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-101s21c1
Sequence:CCGGAGACGGCATCTGGGAACAAAGCTCGAGCTTTGTTCCCAGATGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032486.2-325s1c1
Sequence:CCGGCATGTCTTTATTGAGGAAGATCTCGAGATCTTCCTCAATAAAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032486.2-159s1c1
Sequence:CCGGCGTTCTCAATGGCAAGACCATCTCGAGATGGTCTTGCCATTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032486.2-418s1c1
Sequence:CCGGGTGTTGAAAGACTGCTGCAAACTCGAGTTTGCAGCAGTCTTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032486.2-546s1c1
Sequence:CCGGGCTGATGATTGACGTCACCAACTCGAGTTGGTGACGTCAATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032486
VALIDATED
DCTN5 MISSION shRNA shRNA Plasmid DNA
dynactin 5 (p25)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-418s21c1
Sequence:CCGGGTGTTGAAAGACTGCTGCAAACTCGAGTTTGCAGCAGTCTTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032486.2-842s21c1
Sequence:CCGGACAGTCACTTTGTACCATTATCTCGAGATAATGGTACAAAGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-181s21c1
Sequence:CCGGGTGATGAATGACTGTATTATCCTCGAGGATAATACAGTCATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-219s21c1
Sequence:CCGGTGTAAGAGTTGGACGTCATTGCTCGAGCAATGACGTCCAACTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-101s21c1
Sequence:CCGGAGACGGCATCTGGGAACAAAGCTCGAGCTTTGTTCCCAGATGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032486.2-325s1c1
Sequence:CCGGCATGTCTTTATTGAGGAAGATCTCGAGATCTTCCTCAATAAAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032486.2-159s1c1
Sequence:CCGGCGTTCTCAATGGCAAGACCATCTCGAGATGGTCTTGCCATTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032486.2-418s1c1
Sequence:CCGGGTGTTGAAAGACTGCTGCAAACTCGAGTTTGCAGCAGTCTTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032486.2-546s1c1
Sequence:CCGGGCTGATGATTGACGTCACCAACTCGAGTTGGTGACGTCAATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032486
VALIDATED
DCTN5 MISSION shRNA Lentiviral Transduction Particles
dynactin 5 (p25)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-418s21c1
Sequence:CCGGGTGTTGAAAGACTGCTGCAAACTCGAGTTTGCAGCAGTCTTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032486.2-842s21c1
Sequence:CCGGACAGTCACTTTGTACCATTATCTCGAGATAATGGTACAAAGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-181s21c1
Sequence:CCGGGTGATGAATGACTGTATTATCCTCGAGGATAATACAGTCATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-219s21c1
Sequence:CCGGTGTAAGAGTTGGACGTCATTGCTCGAGCAATGACGTCCAACTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_032486.2-101s21c1
Sequence:CCGGAGACGGCATCTGGGAACAAAGCTCGAGCTTTGTTCCCAGATGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032486.2-325s1c1
Sequence:CCGGCATGTCTTTATTGAGGAAGATCTCGAGATCTTCCTCAATAAAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032486.2-159s1c1
Sequence:CCGGCGTTCTCAATGGCAAGACCATCTCGAGATGGTCTTGCCATTGAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032486.2-418s1c1
Sequence:CCGGGTGTTGAAAGACTGCTGCAAACTCGAGTTTGCAGCAGTCTTTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032486.2-546s1c1
Sequence:CCGGGCTGATGATTGACGTCACCAACTCGAGTTGGTGACGTCAATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks