EMAIL THIS PAGE TO A FRIEND

DCTN6

dynactin 6

56 Gene Product Result for
Synonyms: WS-3 WS3 p27
UniProtKB ID: O00399, B2RAC1
Gene ID:
Human(10671) Summary: The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which confers adhesive properties to macromolecular proteins like fibronectin. It shares a high degree of sequence similarity with the mouse homolog, which has been suggested to play a role in mitochondrial biogenesis. The exact biological function of this gene is not known. [provided by RefSeq, Jul 2008]
Mouse(22428) dynactin 6
Rat(290798) dynactin 6
Goat(100861094) dynactin 6
sheep(101104551) dynactin 6
chicken(771257) dynactin 6
cow(513751) dynactin 6
dog(475600) dynactin 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006571 Rosetta Predictions human pricing
NM_001106085 Rosetta Predictions rat pricing
NM_011722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032140 predicted 727
2 SASI_Hs01_00032141 predicted 412
3 SASI_Hs01_00032142 predicted 563
4 SASI_Hs02_00341854 predicted 595
5 SASI_Hs01_00032143 predicted 348
6 SASI_Hs02_00341855 predicted 626
7 SASI_Hs01_00032144 predicted 339
8 SASI_Hs01_00032146 predicted 718
9 SASI_Hs02_00341856 predicted 364
10 SASI_Hs01_00032147 predicted 650
11 SASI_Hs01_00032139 predicted 330
12 SASI_Hs01_00032145 predicted 387
13 SASI_Hs01_00032148 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215482 predicted 584
2 SASI_Rn02_00215483 predicted 706
3 SASI_Rn02_00215484 predicted 556
4 SASI_Rn02_00215485 predicted 700
5 SASI_Rn02_00215486 predicted 382
6 SASI_Rn02_00215487 predicted 429
7 SASI_Rn02_00215488 predicted 485
8 SASI_Rn02_00215489 predicted 744
9 SASI_Rn02_00215490 predicted 612
10 SASI_Rn02_00215491 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043184 predicted 658
2 SASI_Mm01_00043185 predicted 413
3 SASI_Mm01_00043187 predicted 507
4 SASI_Mm01_00043188 predicted 238
5 SASI_Mm01_00043189 predicted 625
6 SASI_Mm02_00321289 predicted 353
7 SASI_Mm01_00043191 predicted 277
8 SASI_Mm02_00321290 predicted 624
9 SASI_Mm01_00043192 predicted 663
10 SASI_Mm01_00043193 predicted 310
11 SASI_Mm01_00043186 predicted 633
12 SASI_Mm01_00043190 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011722
VALIDATED
DCTN6 MISSION shRNA Bacterial Glycerol Stock
dynactin 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-676s1c1
Sequence:CCGGCCTATTGTAACGACCGCTATACTCGAGTATAGCGGTCGTTACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-107s1c1
Sequence:CCGGCCACCCTAAAGCACGAATTATCTCGAGATAATTCGTGCTTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-202s1c1
Sequence:CCGGCGGATAACATCATCCCAGATACTCGAGTATCTGGGATGATGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011722.1-479s1c1
Sequence:CCGGCCAGACTTTACAACTGGATTTCTCGAGAAATCCAGTTGTAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-104s1c1
Sequence:CCGGGATCCACCCTAAAGCACGAATCTCGAGATTCGTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-172s21c1
Sequence:CCGGGATCCACCCTAAAGCACGAATCTCGAGATTCGTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011722.3-270s21c1
Sequence:CCGGCGGATAACATCATCCCAGATACTCGAGTATCTGGGATGATGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-241s21c1
Sequence:CCGGAGAGCAGGCCCTCATCATAAACTCGAGTTTATGATGAGGGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-319s21c1
Sequence:CCGGTATTGGCACCAACAACGTATTCTCGAGAATACGTTGTTGGTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011722
VALIDATED
DCTN6 MISSION shRNA shRNA Plasmid DNA
dynactin 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-676s1c1
Sequence:CCGGCCTATTGTAACGACCGCTATACTCGAGTATAGCGGTCGTTACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-107s1c1
Sequence:CCGGCCACCCTAAAGCACGAATTATCTCGAGATAATTCGTGCTTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-202s1c1
Sequence:CCGGCGGATAACATCATCCCAGATACTCGAGTATCTGGGATGATGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011722.1-479s1c1
Sequence:CCGGCCAGACTTTACAACTGGATTTCTCGAGAAATCCAGTTGTAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-104s1c1
Sequence:CCGGGATCCACCCTAAAGCACGAATCTCGAGATTCGTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-172s21c1
Sequence:CCGGGATCCACCCTAAAGCACGAATCTCGAGATTCGTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011722.3-270s21c1
Sequence:CCGGCGGATAACATCATCCCAGATACTCGAGTATCTGGGATGATGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-241s21c1
Sequence:CCGGAGAGCAGGCCCTCATCATAAACTCGAGTTTATGATGAGGGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-319s21c1
Sequence:CCGGTATTGGCACCAACAACGTATTCTCGAGAATACGTTGTTGGTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011722
VALIDATED
DCTN6 MISSION shRNA Lentiviral Transduction Particles
dynactin 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-676s1c1
Sequence:CCGGCCTATTGTAACGACCGCTATACTCGAGTATAGCGGTCGTTACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-107s1c1
Sequence:CCGGCCACCCTAAAGCACGAATTATCTCGAGATAATTCGTGCTTTAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-202s1c1
Sequence:CCGGCGGATAACATCATCCCAGATACTCGAGTATCTGGGATGATGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011722.1-479s1c1
Sequence:CCGGCCAGACTTTACAACTGGATTTCTCGAGAAATCCAGTTGTAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011722.1-104s1c1
Sequence:CCGGGATCCACCCTAAAGCACGAATCTCGAGATTCGTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-172s21c1
Sequence:CCGGGATCCACCCTAAAGCACGAATCTCGAGATTCGTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011722.3-270s21c1
Sequence:CCGGCGGATAACATCATCCCAGATACTCGAGTATCTGGGATGATGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-241s21c1
Sequence:CCGGAGAGCAGGCCCTCATCATAAACTCGAGTTTATGATGAGGGCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011722.3-319s21c1
Sequence:CCGGTATTGGCACCAACAACGTATTCTCGAGAATACGTTGTTGGTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006571
VALIDATED
DCTN6 MISSION shRNA Bacterial Glycerol Stock
dynactin 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-498s1c1
Sequence:CCGGCCCTGAGAATACGGTGATCTACTCGAGTAGATCACCGTATTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-379s1c1
Sequence:CCGGGCCATGAAGATGGGAGATAATCTCGAGATTATCTCCCATCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006571.2-241s1c1
Sequence:CCGGGAAGGGAACCTAATAGAAGAACTCGAGTTCTTCTATTAGGTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-329s1c1
Sequence:CCGGCTATGATCATTGGCACCAATACTCGAGTATTGGTGCCAATGATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-189s1c1
Sequence:CCGGGATCCACCCTAAAGCAAGAATCTCGAGATTCTTGCTTTAGGGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-600s1c1
Sequence:CCGGGCCAAATTACCACCACCTAAACTCGAGTTTAGGTGGTGGTAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-328s1c1
Sequence:CCGGCCTATGATCATTGGCACCAATCTCGAGATTGGTGCCAATGATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006571.2-718s1c1
Sequence:CCGGCCCACAGTGTTTATGTACTCTCTCGAGAGAGTACATAAACACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-241s21c1
Sequence:CCGGGAAGGGAACCTAATAGAAGAACTCGAGTTCTTCTATTAGGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006571.2-718s21c1
Sequence:CCGGCCCACAGTGTTTATGTACTCTCTCGAGAGAGTACATAAACACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-498s21c1
Sequence:CCGGCCCTGAGAATACGGTGATCTACTCGAGTAGATCACCGTATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-189s21c1
Sequence:CCGGGATCCACCCTAAAGCAAGAATCTCGAGATTCTTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006571
VALIDATED
DCTN6 MISSION shRNA shRNA Plasmid DNA
dynactin 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-498s1c1
Sequence:CCGGCCCTGAGAATACGGTGATCTACTCGAGTAGATCACCGTATTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-379s1c1
Sequence:CCGGGCCATGAAGATGGGAGATAATCTCGAGATTATCTCCCATCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006571.2-241s1c1
Sequence:CCGGGAAGGGAACCTAATAGAAGAACTCGAGTTCTTCTATTAGGTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-329s1c1
Sequence:CCGGCTATGATCATTGGCACCAATACTCGAGTATTGGTGCCAATGATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-189s1c1
Sequence:CCGGGATCCACCCTAAAGCAAGAATCTCGAGATTCTTGCTTTAGGGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-600s1c1
Sequence:CCGGGCCAAATTACCACCACCTAAACTCGAGTTTAGGTGGTGGTAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-328s1c1
Sequence:CCGGCCTATGATCATTGGCACCAATCTCGAGATTGGTGCCAATGATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006571.2-718s1c1
Sequence:CCGGCCCACAGTGTTTATGTACTCTCTCGAGAGAGTACATAAACACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-241s21c1
Sequence:CCGGGAAGGGAACCTAATAGAAGAACTCGAGTTCTTCTATTAGGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006571.2-718s21c1
Sequence:CCGGCCCACAGTGTTTATGTACTCTCTCGAGAGAGTACATAAACACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-498s21c1
Sequence:CCGGCCCTGAGAATACGGTGATCTACTCGAGTAGATCACCGTATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-189s21c1
Sequence:CCGGGATCCACCCTAAAGCAAGAATCTCGAGATTCTTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006571
VALIDATED
DCTN6 MISSION shRNA Lentiviral Transduction Particles
dynactin 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-498s1c1
Sequence:CCGGCCCTGAGAATACGGTGATCTACTCGAGTAGATCACCGTATTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-379s1c1
Sequence:CCGGGCCATGAAGATGGGAGATAATCTCGAGATTATCTCCCATCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006571.2-241s1c1
Sequence:CCGGGAAGGGAACCTAATAGAAGAACTCGAGTTCTTCTATTAGGTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-329s1c1
Sequence:CCGGCTATGATCATTGGCACCAATACTCGAGTATTGGTGCCAATGATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006571.2-189s1c1
Sequence:CCGGGATCCACCCTAAAGCAAGAATCTCGAGATTCTTGCTTTAGGGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-600s1c1
Sequence:CCGGGCCAAATTACCACCACCTAAACTCGAGTTTAGGTGGTGGTAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006571.2-328s1c1
Sequence:CCGGCCTATGATCATTGGCACCAATCTCGAGATTGGTGCCAATGATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006571.2-718s1c1
Sequence:CCGGCCCACAGTGTTTATGTACTCTCTCGAGAGAGTACATAAACACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-241s21c1
Sequence:CCGGGAAGGGAACCTAATAGAAGAACTCGAGTTCTTCTATTAGGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006571.2-718s21c1
Sequence:CCGGCCCACAGTGTTTATGTACTCTCTCGAGAGAGTACATAAACACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-498s21c1
Sequence:CCGGCCCTGAGAATACGGTGATCTACTCGAGTAGATCACCGTATTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006571.2-189s21c1
Sequence:CCGGGATCCACCCTAAAGCAAGAATCTCGAGATTCTTGCTTTAGGGTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks