EMAIL THIS PAGE TO A FRIEND

DCTPP1

dCTP pyrophosphatase 1

76 Gene Product Result for
Synonyms: RS21C6 XTP3TPA
UniProtKB ID: Q9H773
Gene ID:
Mouse(66422) dCTP pyrophosphatase 1
Rat(192252) dCTP pyrophosphatase 1
dog(489903) dCTP pyrophosphatase 1-like
domestic cat(101094313) dCTP pyrophosphatase 1
cow(614103) dCTP pyrophosphatase 1
sheep(101121995) dCTP pyrophosphatase 1
naked mole-rat(101722931) dCTP pyrophosphatase 1
domestic guinea pig(100729302) dCTP pyrophosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024096 Rosetta Predictions human pricing
NM_138892 Rosetta Predictions rat pricing
NM_023203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014964 predicted 410
2 SASI_Hs01_00014965 predicted 264
3 SASI_Hs01_00014966 predicted 591
4 SASI_Hs01_00014967 predicted 335
5 SASI_Hs01_00014968 predicted 570
6 SASI_Hs01_00014969 predicted 370
7 SASI_Hs02_00356575 predicted 458
8 SASI_Hs01_00014970 predicted 352
9 SASI_Hs01_00014971 predicted 194
10 SASI_Hs01_00014973 predicted 207
11 SASI_Hs01_00014972 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072436 predicted 332
2 SASI_Rn01_00072437 predicted 210
3 SASI_Rn01_00072438 predicted 216
4 SASI_Rn01_00072439 predicted 221
5 SASI_Rn01_00072440 predicted 329
6 SASI_Rn02_00268337 predicted 385
7 SASI_Rn02_00268338 predicted 393
8 SASI_Rn02_00268339 predicted 371
9 SASI_Rn02_00268340 predicted 240
10 SASI_Rn02_00268341 predicted 358
11 SASI_Rn01_00072441 predicted 112
12 SASI_Rn01_00072442 predicted 90
13 SASI_Rn01_00072443 predicted 116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026166 predicted 385
2 SASI_Mm01_00026167 predicted 209
3 SASI_Mm01_00026170 predicted 236
4 SASI_Mm01_00026171 predicted 336
5 SASI_Mm01_00026172 predicted 300
6 SASI_Mm02_00326946 predicted 235
7 SASI_Mm02_00326947 predicted 336
8 SASI_Mm02_00326948 predicted 254
9 SASI_Mm02_00326949 predicted 323
10 SASI_Mm02_00326950 predicted 319
11 SASI_Mm01_00026165 predicted 363
12 SASI_Mm01_00026168 predicted 369
13 SASI_Mm01_00026169 predicted 383
14 SASI_Mm01_00026173 predicted 368
15 SASI_Mm01_00026174 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023203
VALIDATED
DCTPP1 MISSION shRNA Bacterial Glycerol Stock
dCTP pyrophosphatase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-247s21c1
Sequence:CCGGCAGAACTCTTCCAGTGGAAGTCTCGAGACTTCCACTGGAAGAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-378s21c1
Sequence:CCGGGTGGATTTACCTCAAGCAGTACTCGAGTACTGCTTGAGGTAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-341s21c1
Sequence:CCGGCCTCATCTACCTGGTAGCATTCTCGAGAATGCTACCAGGTAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-257s21c1
Sequence:CCGGCCAGTGGAAGTCTGATACAGACTCGAGTCTGTATCAGACTTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-257s1c1
Sequence:CCGGCCAGTGGAAGTCTGATACAGACTCGAGTCTGTATCAGACTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-378s1c1
Sequence:CCGGGTGGATTTACCTCAAGCAGTACTCGAGTACTGCTTGAGGTAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023203.1-342s1c1
Sequence:CCGGCTCATCTACCTGGTAGCATTACTCGAGTAATGCTACCAGGTAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-341s1c1
Sequence:CCGGCCTCATCTACCTGGTAGCATTCTCGAGAATGCTACCAGGTAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-247s1c1
Sequence:CCGGCAGAACTCTTCCAGTGGAAGTCTCGAGACTTCCACTGGAAGAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023203
VALIDATED
DCTPP1 MISSION shRNA shRNA Plasmid DNA
dCTP pyrophosphatase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-247s21c1
Sequence:CCGGCAGAACTCTTCCAGTGGAAGTCTCGAGACTTCCACTGGAAGAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-378s21c1
Sequence:CCGGGTGGATTTACCTCAAGCAGTACTCGAGTACTGCTTGAGGTAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-341s21c1
Sequence:CCGGCCTCATCTACCTGGTAGCATTCTCGAGAATGCTACCAGGTAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-257s21c1
Sequence:CCGGCCAGTGGAAGTCTGATACAGACTCGAGTCTGTATCAGACTTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-257s1c1
Sequence:CCGGCCAGTGGAAGTCTGATACAGACTCGAGTCTGTATCAGACTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-378s1c1
Sequence:CCGGGTGGATTTACCTCAAGCAGTACTCGAGTACTGCTTGAGGTAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023203.1-342s1c1
Sequence:CCGGCTCATCTACCTGGTAGCATTACTCGAGTAATGCTACCAGGTAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-341s1c1
Sequence:CCGGCCTCATCTACCTGGTAGCATTCTCGAGAATGCTACCAGGTAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-247s1c1
Sequence:CCGGCAGAACTCTTCCAGTGGAAGTCTCGAGACTTCCACTGGAAGAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023203
VALIDATED
DCTPP1 MISSION shRNA Lentiviral Transduction Particles
dCTP pyrophosphatase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-247s21c1
Sequence:CCGGCAGAACTCTTCCAGTGGAAGTCTCGAGACTTCCACTGGAAGAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-378s21c1
Sequence:CCGGGTGGATTTACCTCAAGCAGTACTCGAGTACTGCTTGAGGTAAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-341s21c1
Sequence:CCGGCCTCATCTACCTGGTAGCATTCTCGAGAATGCTACCAGGTAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023203.1-257s21c1
Sequence:CCGGCCAGTGGAAGTCTGATACAGACTCGAGTCTGTATCAGACTTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-257s1c1
Sequence:CCGGCCAGTGGAAGTCTGATACAGACTCGAGTCTGTATCAGACTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-378s1c1
Sequence:CCGGGTGGATTTACCTCAAGCAGTACTCGAGTACTGCTTGAGGTAAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023203.1-342s1c1
Sequence:CCGGCTCATCTACCTGGTAGCATTACTCGAGTAATGCTACCAGGTAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-341s1c1
Sequence:CCGGCCTCATCTACCTGGTAGCATTCTCGAGAATGCTACCAGGTAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023203.1-247s1c1
Sequence:CCGGCAGAACTCTTCCAGTGGAAGTCTCGAGACTTCCACTGGAAGAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024096
VALIDATED
DCTPP1 MISSION shRNA Bacterial Glycerol Stock
dCTP pyrophosphatase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000167966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-919s1c1
Sequence:CCGGCTAGCAAATTCCCAGTAGGATCTCGAGATCCTACTGGGAATTTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166884    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024096.1-962s1c1
Sequence:CCGGCTTAGAGATTGAAGGCTGTAACTCGAGTTACAGCCTTCAATCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-487s1c1
Sequence:CCGGCGCAAGTATACAGAATTGCCCCTCGAGGGGCAATTCTGTATACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-358s1c1
Sequence:CCGGCTTAGTGACGTCCTCATCTACCTCGAGGTAGATGAGGACGTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024096
VALIDATED
DCTPP1 MISSION shRNA shRNA Plasmid DNA
dCTP pyrophosphatase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000167966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-919s1c1
Sequence:CCGGCTAGCAAATTCCCAGTAGGATCTCGAGATCCTACTGGGAATTTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166884    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024096.1-962s1c1
Sequence:CCGGCTTAGAGATTGAAGGCTGTAACTCGAGTTACAGCCTTCAATCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-487s1c1
Sequence:CCGGCGCAAGTATACAGAATTGCCCCTCGAGGGGCAATTCTGTATACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-358s1c1
Sequence:CCGGCTTAGTGACGTCCTCATCTACCTCGAGGTAGATGAGGACGTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024096
VALIDATED
DCTPP1 MISSION shRNA Lentiviral Transduction Particles
dCTP pyrophosphatase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000167966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-919s1c1
Sequence:CCGGCTAGCAAATTCCCAGTAGGATCTCGAGATCCTACTGGGAATTTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166884    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024096.1-962s1c1
Sequence:CCGGCTTAGAGATTGAAGGCTGTAACTCGAGTTACAGCCTTCAATCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-487s1c1
Sequence:CCGGCGCAAGTATACAGAATTGCCCCTCGAGGGGCAATTCTGTATACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024096.1-358s1c1
Sequence:CCGGCTTAGTGACGTCCTCATCTACCTCGAGGTAGATGAGGACGTCACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks