EMAIL THIS PAGE TO A FRIEND

DCUN1D1

DCN1, defective in cullin neddylation 1, domain containing 1

226 Gene Product Result for
Synonyms: DCNL1 DCUN1L1 RP42 SCCRO SCRO Tes3
UniProtKB ID: Q96GG9, B2RB37, Q7L3G9, Q8TEX7, Q9H6M1, Q9HCT3
Gene ID:
Mouse(114893) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
Rat(310324) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
domestic guinea pig(100725414) DCN1, defective in cullin neddylation 1, domain containing 1
naked mole-rat(101725693) DCN1, defective in cullin neddylation 1, domain containing 1
sheep(101103689) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
Zebrafish(327232) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
dog(606979) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
chicken(424963) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
cow(539869) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
domestic cat(101099394) DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020640 Rosetta Predictions human pricing
NM_001107668 Rosetta Predictions rat pricing
NM_033623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237580 predicted 707
2 SASI_Hs01_00237582 predicted 919
3 SASI_Hs01_00237583 predicted 807
4 SASI_Hs01_00237584 predicted 591
5 SASI_Hs01_00237585 predicted 773
6 SASI_Hs01_00237586 predicted 711
7 SASI_Hs02_00353617 predicted 814
8 SASI_Hs01_00237587 predicted 409
9 SASI_Hs01_00237588 predicted 646
10 SASI_Hs02_00353618 predicted 232
11 SASI_Hs01_00237579 predicted 847
12 SASI_Hs01_00237581 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231095 predicted 691
2 SASI_Rn02_00231096 predicted 239
3 SASI_Rn02_00231097 predicted 244
4 SASI_Rn02_00231098 predicted 565
5 SASI_Rn02_00231099 predicted 685
6 SASI_Rn02_00231100 predicted 210
7 SASI_Rn02_00231101 predicted 217
8 SASI_Rn02_00231102 predicted 750
9 SASI_Rn02_00231103 predicted 280
10 SASI_Rn02_00231104 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337480 predicted 671
2 SASI_Mm01_00167257 predicted 225
3 SASI_Mm01_00167260 predicted 883
4 SASI_Mm02_00337481 predicted 663
5 SASI_Mm02_00337482 predicted 200
6 SASI_Mm01_00167262 predicted 763
7 SASI_Mm02_00337483 predicted 897
8 SASI_Mm01_00167263 predicted 732
9 SASI_Mm02_00337484 predicted 986
10 SASI_Mm02_00337485 predicted 782
11 SASI_Mm01_00167256 predicted 915
12 SASI_Mm01_00167258 predicted 235
13 SASI_Mm01_00167259 predicted 968
14 SASI_Mm01_00167261 predicted 854
15 SASI_Mm01_00167264 predicted 270
16 SASI_Mm01_00167265 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033623
VALIDATED
DCUN1D1 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033623.2-744s1c1
Sequence:CCGGCCTGTCCTTATTGATGACTTTCTCGAGAAAGTCATCAATAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033623.2-2333s1c1
Sequence:CCGGCGGAACAATTTATGCAGATATCTCGAGATATCTGCATAAATTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033623.2-111s1c1
Sequence:CCGGGCAGTAAGTTGTCTTTCTCAACTCGAGTTGAGAAAGACAACTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033623.2-1441s1c1
Sequence:CCGGCCCTGAAATATGTCTTGTGTTCTCGAGAACACAAGACATATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033623.2-2332s1c1
Sequence:CCGGGCGGAACAATTTATGCAGATACTCGAGTATCTGCATAAATTGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-989s21c1
Sequence:CCGGTGAAGATCAATCCTCATAATTCTCGAGAATTATGAGGATTGATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-893s21c1
Sequence:CCGGGTACAACAGTGTAGCACTAAACTCGAGTTTAGTGCTACACTGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-797s21c1
Sequence:CCGGCAGATGACATGTCCAATTATGCTCGAGCATAATTGGACATGTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-422s21c1
Sequence:CCGGGCATCAGTGTGTTGATCATTGCTCGAGCAATGATCAACACACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033623.5-730s21c1
Sequence:CCGGGAGCATCATAAACGATCAATACTCGAGTATTGATCGTTTATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033623
VALIDATED
DCUN1D1 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033623.2-744s1c1
Sequence:CCGGCCTGTCCTTATTGATGACTTTCTCGAGAAAGTCATCAATAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033623.2-2333s1c1
Sequence:CCGGCGGAACAATTTATGCAGATATCTCGAGATATCTGCATAAATTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033623.2-111s1c1
Sequence:CCGGGCAGTAAGTTGTCTTTCTCAACTCGAGTTGAGAAAGACAACTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033623.2-1441s1c1
Sequence:CCGGCCCTGAAATATGTCTTGTGTTCTCGAGAACACAAGACATATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033623.2-2332s1c1
Sequence:CCGGGCGGAACAATTTATGCAGATACTCGAGTATCTGCATAAATTGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-989s21c1
Sequence:CCGGTGAAGATCAATCCTCATAATTCTCGAGAATTATGAGGATTGATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-893s21c1
Sequence:CCGGGTACAACAGTGTAGCACTAAACTCGAGTTTAGTGCTACACTGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-797s21c1
Sequence:CCGGCAGATGACATGTCCAATTATGCTCGAGCATAATTGGACATGTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-422s21c1
Sequence:CCGGGCATCAGTGTGTTGATCATTGCTCGAGCAATGATCAACACACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033623.5-730s21c1
Sequence:CCGGGAGCATCATAAACGATCAATACTCGAGTATTGATCGTTTATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033623
VALIDATED
DCUN1D1 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033623.2-744s1c1
Sequence:CCGGCCTGTCCTTATTGATGACTTTCTCGAGAAAGTCATCAATAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033623.2-2333s1c1
Sequence:CCGGCGGAACAATTTATGCAGATATCTCGAGATATCTGCATAAATTGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033623.2-111s1c1
Sequence:CCGGGCAGTAAGTTGTCTTTCTCAACTCGAGTTGAGAAAGACAACTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033623.2-1441s1c1
Sequence:CCGGCCCTGAAATATGTCTTGTGTTCTCGAGAACACAAGACATATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033623.2-2332s1c1
Sequence:CCGGGCGGAACAATTTATGCAGATACTCGAGTATCTGCATAAATTGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-989s21c1
Sequence:CCGGTGAAGATCAATCCTCATAATTCTCGAGAATTATGAGGATTGATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-893s21c1
Sequence:CCGGGTACAACAGTGTAGCACTAAACTCGAGTTTAGTGCTACACTGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-797s21c1
Sequence:CCGGCAGATGACATGTCCAATTATGCTCGAGCATAATTGGACATGTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033623.5-422s21c1
Sequence:CCGGGCATCAGTGTGTTGATCATTGCTCGAGCAATGATCAACACACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033623.5-730s21c1
Sequence:CCGGGAGCATCATAAACGATCAATACTCGAGTATTGATCGTTTATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020640
VALIDATED
DCUN1D1 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020640.2-1285s1c1
Sequence:CCGGGCACTTCCAGTGAGAGTGATACTCGAGTATCACTCTCACTGGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-397s1c1
Sequence:CCGGGTTCTCCAAACAGGAGTTCATCTCGAGATGAACTCCTGTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020640.2-467s1c1
Sequence:CCGGCAGATACCCAAGATGGAACAACTCGAGTTGTTCCATCTTGGGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-355s1c1
Sequence:CCGGGTTGATTATTGCGTGGAAGTTCTCGAGAACTTCCACGCAATAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-235s1c1
Sequence:CCGGGAAGAAGTTAGAACAGCTGTACTCGAGTACAGCTGTTCTAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-2035s1c1
Sequence:CCGGGCTTCTAGTCTCTTTACTGTTCTCGAGAACAGTAAAGAGACTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-757s1c1
Sequence:CCGGGCCTGTTCTTATTGATGACTTCTCGAGAAGTCATCAATAAGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020640.2-1521s1c1
Sequence:CCGGGCTTACCTTACCCATGTTTATCTCGAGATAAACATGGGTAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-588s1c1
Sequence:CCGGCCTACTGGAACTTAGTGCTTACTCGAGTAAGCACTAAGTTCCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-757s21c1
Sequence:CCGGGCCTGTTCTTATTGATGACTTCTCGAGAAGTCATCAATAAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-235s21c1
Sequence:CCGGGAAGAAGTTAGAACAGCTGTACTCGAGTACAGCTGTTCTAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-467s21c1
Sequence:CCGGCAGATACCCAAGATGGAACAACTCGAGTTGTTCCATCTTGGGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020640.2-1285s21c1
Sequence:CCGGGCACTTCCAGTGAGAGTGATACTCGAGTATCACTCTCACTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-588s21c1
Sequence:CCGGCCTACTGGAACTTAGTGCTTACTCGAGTAAGCACTAAGTTCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020640
VALIDATED
DCUN1D1 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020640.2-1285s1c1
Sequence:CCGGGCACTTCCAGTGAGAGTGATACTCGAGTATCACTCTCACTGGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-397s1c1
Sequence:CCGGGTTCTCCAAACAGGAGTTCATCTCGAGATGAACTCCTGTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020640.2-467s1c1
Sequence:CCGGCAGATACCCAAGATGGAACAACTCGAGTTGTTCCATCTTGGGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-355s1c1
Sequence:CCGGGTTGATTATTGCGTGGAAGTTCTCGAGAACTTCCACGCAATAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-235s1c1
Sequence:CCGGGAAGAAGTTAGAACAGCTGTACTCGAGTACAGCTGTTCTAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-2035s1c1
Sequence:CCGGGCTTCTAGTCTCTTTACTGTTCTCGAGAACAGTAAAGAGACTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-757s1c1
Sequence:CCGGGCCTGTTCTTATTGATGACTTCTCGAGAAGTCATCAATAAGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020640.2-1521s1c1
Sequence:CCGGGCTTACCTTACCCATGTTTATCTCGAGATAAACATGGGTAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-588s1c1
Sequence:CCGGCCTACTGGAACTTAGTGCTTACTCGAGTAAGCACTAAGTTCCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-757s21c1
Sequence:CCGGGCCTGTTCTTATTGATGACTTCTCGAGAAGTCATCAATAAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-235s21c1
Sequence:CCGGGAAGAAGTTAGAACAGCTGTACTCGAGTACAGCTGTTCTAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-467s21c1
Sequence:CCGGCAGATACCCAAGATGGAACAACTCGAGTTGTTCCATCTTGGGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020640.2-1285s21c1
Sequence:CCGGGCACTTCCAGTGAGAGTGATACTCGAGTATCACTCTCACTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-588s21c1
Sequence:CCGGCCTACTGGAACTTAGTGCTTACTCGAGTAAGCACTAAGTTCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020640
VALIDATED
DCUN1D1 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020640.2-1285s1c1
Sequence:CCGGGCACTTCCAGTGAGAGTGATACTCGAGTATCACTCTCACTGGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-397s1c1
Sequence:CCGGGTTCTCCAAACAGGAGTTCATCTCGAGATGAACTCCTGTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020640.2-467s1c1
Sequence:CCGGCAGATACCCAAGATGGAACAACTCGAGTTGTTCCATCTTGGGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-355s1c1
Sequence:CCGGGTTGATTATTGCGTGGAAGTTCTCGAGAACTTCCACGCAATAATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-235s1c1
Sequence:CCGGGAAGAAGTTAGAACAGCTGTACTCGAGTACAGCTGTTCTAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-2035s1c1
Sequence:CCGGGCTTCTAGTCTCTTTACTGTTCTCGAGAACAGTAAAGAGACTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020640.2-757s1c1
Sequence:CCGGGCCTGTTCTTATTGATGACTTCTCGAGAAGTCATCAATAAGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020640.2-1521s1c1
Sequence:CCGGGCTTACCTTACCCATGTTTATCTCGAGATAAACATGGGTAAGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020640.2-588s1c1
Sequence:CCGGCCTACTGGAACTTAGTGCTTACTCGAGTAAGCACTAAGTTCCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-757s21c1
Sequence:CCGGGCCTGTTCTTATTGATGACTTCTCGAGAAGTCATCAATAAGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-235s21c1
Sequence:CCGGGAAGAAGTTAGAACAGCTGTACTCGAGTACAGCTGTTCTAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-467s21c1
Sequence:CCGGCAGATACCCAAGATGGAACAACTCGAGTTGTTCCATCTTGGGTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020640.2-1285s21c1
Sequence:CCGGGCACTTCCAGTGAGAGTGATACTCGAGTATCACTCTCACTGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020640.2-588s21c1
Sequence:CCGGCCTACTGGAACTTAGTGCTTACTCGAGTAAGCACTAAGTTCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks