EMAIL THIS PAGE TO A FRIEND

DCUN1D2

DCN1, defective in cullin neddylation 1, domain containing 2

101 Gene Product Result for
Synonyms: C13orf17
UniProtKB ID: Q6PH85, Q5JSA5, Q5JSA6, Q5JSA7, Q9NVJ1, Q9NXR6
Gene ID:
Mouse(102323) DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
Rat(688913) DCN1, defective in cullin neddylation 1, domain containing 2
Zebrafish(415246) DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
chicken(418740) DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
cow(618507) DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
domestic cat(101098512) DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
dog(476997) DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
sheep(101120174) DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
naked mole-rat(101699628) DCN1, defective in cullin neddylation 1, domain containing 2
domestic guinea pig(100726054) DCN1, defective in cullin neddylation 1, domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018185 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014283 Rosetta Predictions human pricing
NM_018185 Rosetta Predictions human pricing
NM_001134798 Rosetta Predictions rat pricing
NM_001024504 Rosetta Predictions mouse pricing
NM_001042649 Rosetta Predictions mouse pricing
NM_001042650 Rosetta Predictions mouse pricing
NM_001042651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306518 predicted 893
2 SASI_Hs02_00306519 predicted 442
3 SASI_Hs02_00306520 predicted 573
4 SASI_Hs02_00306521 predicted 590
5 SASI_Hs01_00101102 predicted 819
6 SASI_Hs02_00306522 predicted 411
7 SASI_Hs02_00306523 predicted 635
8 SASI_Hs02_00306524 predicted 343
9 SASI_Hs02_00306525 predicted 839
10 SASI_Hs02_00306526 predicted 334
11 SASI_Hs01_00101096 predicted 236
12 SASI_Hs01_00101097 predicted 1037
13 SASI_Hs01_00101098 predicted 838
14 SASI_Hs01_00101099 predicted 788
15 SASI_Hs01_00101100 predicted 250
16 SASI_Hs01_00101101 predicted 1022
17 SASI_Hs01_00101103 predicted 1265
18 SASI_Hs01_00101104 predicted 827
19 SASI_Hs01_00101105 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144017 predicted 984
2 SASI_Hs01_00144018 predicted 1051
3 SASI_Hs01_00144019 predicted 990
4 SASI_Hs01_00144020 predicted 634
5 SASI_Hs01_00144021 predicted 442
6 SASI_Hs01_00144022 predicted 639
7 SASI_Hs01_00144023 predicted 416
8 SASI_Hs01_00144024 predicted 101
9 SASI_Hs01_00144025 predicted 120
10 SASI_Hs01_00144026 predicted 82
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258564 predicted 226
2 SASI_Rn02_00258565 predicted 901
3 SASI_Rn02_00258566 predicted 724
4 SASI_Rn02_00258567 predicted 443
5 SASI_Rn02_00258568 predicted 252
6 SASI_Rn02_00258569 predicted 1040
7 SASI_Rn02_00258570 predicted 1066
8 SASI_Rn02_00258571 predicted 666
9 SASI_Rn02_00258572 predicted 1061
10 SASI_Rn02_00258573 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287592 predicted 460
2 SASI_Mm02_00287593 predicted 1282
3 SASI_Mm02_00287594 predicted 467
4 SASI_Mm02_00287595 predicted 1490
5 SASI_Mm01_00048055 predicted 560
6 SASI_Mm02_00287596 predicted 388
7 SASI_Mm02_00287597 predicted 1311
8 SASI_Mm02_00287598 predicted 1579
9 SASI_Mm02_00287599 predicted 422
10 SASI_Mm01_00048060 predicted 532
11 SASI_Mm01_00048053 predicted 286
12 SASI_Mm01_00048054 predicted 571
13 SASI_Mm01_00048056 predicted 488
14 SASI_Mm01_00048057 predicted 861
15 SASI_Mm01_00048058 predicted 970
16 SASI_Mm01_00048059 predicted 824
17 SASI_Mm01_00048061 predicted 618
18 SASI_Mm01_00048062 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290815 predicted 567
2 SASI_Mm02_00290816 predicted 461
3 SASI_Mm02_00290817 predicted 1202
4 SASI_Mm02_00290818 predicted 463
5 SASI_Mm02_00290819 predicted 1402
6 SASI_Mm02_00290820 predicted 562
7 SASI_Mm02_00290821 predicted 396
8 SASI_Mm02_00290822 predicted 1229
9 SASI_Mm02_00290823 predicted 420
10 SASI_Mm02_00290824 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290825 predicted 464
2 SASI_Mm02_00290826 predicted 1110
3 SASI_Mm02_00290827 predicted 462
4 SASI_Mm02_00290828 predicted 1310
5 SASI_Mm02_00290829 predicted 558
6 SASI_Mm02_00290830 predicted 389
7 SASI_Mm02_00290831 predicted 1128
8 SASI_Mm02_00290832 predicted 1398
9 SASI_Mm02_00290833 predicted 424
10 SASI_Mm02_00290834 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290835 predicted 567
2 SASI_Mm02_00290836 predicted 457
3 SASI_Mm02_00290837 predicted 1193
4 SASI_Mm02_00290838 predicted 465
5 SASI_Mm02_00290839 predicted 1389
6 SASI_Mm02_00290840 predicted 559
7 SASI_Mm02_00290841 predicted 391
8 SASI_Mm02_00290842 predicted 1208
9 SASI_Mm02_00290843 predicted 417
10 SASI_Mm02_00290844 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014283
VALIDATED
DCUN1D2 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000350923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014283.1-371s21c1
Sequence:CCGGCAGCAACTCAGTGTGAATTTACTCGAGTAAATTCACACTGAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014283.1-1290s21c1
Sequence:CCGGGATCTTGTCGTAGAGTCTAATCTCGAGATTAGACTCTACGACAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001014283.1-104s21c1
Sequence:CCGGGCGAGAGAACTGCTATCTACTCTCGAGAGTAGATAGCAGTTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014283.1-383s21c1
Sequence:CCGGGTGAATTTAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014283
VALIDATED
DCUN1D2 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000350923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014283.1-371s21c1
Sequence:CCGGCAGCAACTCAGTGTGAATTTACTCGAGTAAATTCACACTGAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014283.1-1290s21c1
Sequence:CCGGGATCTTGTCGTAGAGTCTAATCTCGAGATTAGACTCTACGACAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001014283.1-104s21c1
Sequence:CCGGGCGAGAGAACTGCTATCTACTCTCGAGAGTAGATAGCAGTTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014283.1-383s21c1
Sequence:CCGGGTGAATTTAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014283
VALIDATED
DCUN1D2 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000350923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014283.1-371s21c1
Sequence:CCGGCAGCAACTCAGTGTGAATTTACTCGAGTAAATTCACACTGAGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014283.1-1290s21c1
Sequence:CCGGGATCTTGTCGTAGAGTCTAATCTCGAGATTAGACTCTACGACAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001014283.1-104s21c1
Sequence:CCGGGCGAGAGAACTGCTATCTACTCTCGAGAGTAGATAGCAGTTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014283.1-383s21c1
Sequence:CCGGGTGAATTTAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024504
VALIDATED
DCUN1D2 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024504.2-858s21c1
Sequence:CCGGGCATATTGGAAGTTAGTATTGCTCGAGCAATACTAACTTCCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024504.2-468s21c1
Sequence:CCGGGCGTTTCACCGAGAGTCTATGCTCGAGCATAGACTCTCGGTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024504.2-1719s21c1
Sequence:CCGGTCTAATGAGGTTATCACTATACTCGAGTATAGTGATAACCTCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024504.2-781s21c1
Sequence:CCGGTCAAGGACCTTTACCAGTTTACTCGAGTAAACTGGTAAAGGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024504.2-652s21c1
Sequence:CCGGCCGCCACTCAATGTGAATTTACTCGAGTAAATTCACATTGAGTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024504
VALIDATED
DCUN1D2 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024504.2-858s21c1
Sequence:CCGGGCATATTGGAAGTTAGTATTGCTCGAGCAATACTAACTTCCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024504.2-468s21c1
Sequence:CCGGGCGTTTCACCGAGAGTCTATGCTCGAGCATAGACTCTCGGTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024504.2-1719s21c1
Sequence:CCGGTCTAATGAGGTTATCACTATACTCGAGTATAGTGATAACCTCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024504.2-781s21c1
Sequence:CCGGTCAAGGACCTTTACCAGTTTACTCGAGTAAACTGGTAAAGGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024504.2-652s21c1
Sequence:CCGGCCGCCACTCAATGTGAATTTACTCGAGTAAATTCACATTGAGTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024504
VALIDATED
DCUN1D2 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024504.2-858s21c1
Sequence:CCGGGCATATTGGAAGTTAGTATTGCTCGAGCAATACTAACTTCCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024504.2-468s21c1
Sequence:CCGGGCGTTTCACCGAGAGTCTATGCTCGAGCATAGACTCTCGGTGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024504.2-1719s21c1
Sequence:CCGGTCTAATGAGGTTATCACTATACTCGAGTATAGTGATAACCTCATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024504.2-781s21c1
Sequence:CCGGTCAAGGACCTTTACCAGTTTACTCGAGTAAACTGGTAAAGGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024504.2-652s21c1
Sequence:CCGGCCGCCACTCAATGTGAATTTACTCGAGTAAATTCACATTGAGTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018185
VALIDATED
DCUN1D2 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-91s1c1
Sequence:CCGGGAGAACTGCTATCTACTGCTTCTCGAGAAGCAGTAGATAGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-431s1c1
Sequence:CCGGCTAAAGGCTCTTCTGCCAAGACTCGAGTCTTGGCAGAAGAGCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018185.1-497s1c1
Sequence:CCGGCAGTTTACCTTCACCTTCGCTCTCGAGAGCGAAGGTGAAGGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018185.1-397s1c1
Sequence:CCGGCATGACAGAACTTGGGTGTGACTCGAGTCACACCCAAGTTCTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-87s1c1
Sequence:CCGGGCGAGAGAACTGCTATCTACTCTCGAGAGTAGATAGCAGTTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-118s1c1
Sequence:CCGGGAATGAGTGGAGACTAGACGACTCGAGTCGTCTAGTCTCCACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-193s1c1
Sequence:CCGGGAACGCTGTGGACAAGAAGAACTCGAGTTCTTCTTGTCCACAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018185.1-525s1c1
Sequence:CCGGCAGGGCAGAAAGGTTTAGGTTCTCGAGAACCTAAACCTTTCTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-93s1c1
Sequence:CCGGGAACTGCTATCTACTGCTTAACTCGAGTTAAGCAGTAGATAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-366s1c1
Sequence:CCGGGTGAATTTAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTAAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-354s1c1
Sequence:CCGGCAGCAACTCAGTGTGAATTTACTCGAGTAAATTCACACTGAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018185
VALIDATED
DCUN1D2 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-91s1c1
Sequence:CCGGGAGAACTGCTATCTACTGCTTCTCGAGAAGCAGTAGATAGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-431s1c1
Sequence:CCGGCTAAAGGCTCTTCTGCCAAGACTCGAGTCTTGGCAGAAGAGCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018185.1-497s1c1
Sequence:CCGGCAGTTTACCTTCACCTTCGCTCTCGAGAGCGAAGGTGAAGGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018185.1-397s1c1
Sequence:CCGGCATGACAGAACTTGGGTGTGACTCGAGTCACACCCAAGTTCTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-87s1c1
Sequence:CCGGGCGAGAGAACTGCTATCTACTCTCGAGAGTAGATAGCAGTTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-118s1c1
Sequence:CCGGGAATGAGTGGAGACTAGACGACTCGAGTCGTCTAGTCTCCACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-193s1c1
Sequence:CCGGGAACGCTGTGGACAAGAAGAACTCGAGTTCTTCTTGTCCACAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018185.1-525s1c1
Sequence:CCGGCAGGGCAGAAAGGTTTAGGTTCTCGAGAACCTAAACCTTTCTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-93s1c1
Sequence:CCGGGAACTGCTATCTACTGCTTAACTCGAGTTAAGCAGTAGATAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-366s1c1
Sequence:CCGGGTGAATTTAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTAAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-354s1c1
Sequence:CCGGCAGCAACTCAGTGTGAATTTACTCGAGTAAATTCACACTGAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018185
VALIDATED
DCUN1D2 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-91s1c1
Sequence:CCGGGAGAACTGCTATCTACTGCTTCTCGAGAAGCAGTAGATAGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-431s1c1
Sequence:CCGGCTAAAGGCTCTTCTGCCAAGACTCGAGTCTTGGCAGAAGAGCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018185.1-497s1c1
Sequence:CCGGCAGTTTACCTTCACCTTCGCTCTCGAGAGCGAAGGTGAAGGTAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018185.1-397s1c1
Sequence:CCGGCATGACAGAACTTGGGTGTGACTCGAGTCACACCCAAGTTCTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-87s1c1
Sequence:CCGGGCGAGAGAACTGCTATCTACTCTCGAGAGTAGATAGCAGTTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-118s1c1
Sequence:CCGGGAATGAGTGGAGACTAGACGACTCGAGTCGTCTAGTCTCCACTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018185.1-193s1c1
Sequence:CCGGGAACGCTGTGGACAAGAAGAACTCGAGTTCTTCTTGTCCACAGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018185.1-525s1c1
Sequence:CCGGCAGGGCAGAAAGGTTTAGGTTCTCGAGAACCTAAACCTTTCTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-93s1c1
Sequence:CCGGGAACTGCTATCTACTGCTTAACTCGAGTTAAGCAGTAGATAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-366s1c1
Sequence:CCGGGTGAATTTAGCAGAAAGGAATCTCGAGATTCCTTTCTGCTAAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018185.1-354s1c1
Sequence:CCGGCAGCAACTCAGTGTGAATTTACTCGAGTAAATTCACACTGAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks