EMAIL THIS PAGE TO A FRIEND

DCUN1D3

DCN1, defective in cullin neddylation 1, domain containing 3

214 Gene Product Result for
Synonyms: 44M2.4
UniProtKB ID: Q8IWE4, B3KVY4
Gene ID:
Mouse(233805) DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
Rat(309035) DCN1, defective in cullin neddylation 1, domain containing 3
chicken(427002) DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
cow(504926) DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
domestic cat(101081775) DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
dog(489983) DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
domestic guinea pig(100716861) DCN1, defective in cullin neddylation 1, domain containing 3
naked mole-rat(101701170) DCN1, defective in cullin neddylation 1, domain containing 3
sheep(101122244) DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173475 Rosetta Predictions human pricing
NM_001024886 Rosetta Predictions rat pricing
NM_173408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368232 predicted 773
2 SASI_Hs01_00212690 predicted 894
3 SASI_Hs01_00212691 predicted 888
4 SASI_Hs02_00368233 predicted 751
5 SASI_Hs01_00212692 predicted 688
6 SASI_Hs01_00212693 predicted 1066
7 SASI_Hs01_00212694 predicted 860
8 SASI_Hs01_00212695 predicted 909
9 SASI_Hs01_00212697 predicted 909
10 SASI_Hs01_00212698 predicted 524
11 SASI_Hs01_00212696 predicted 843
12 SASI_Hs01_00212699 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050853 predicted 847
2 SASI_Rn01_00050854 predicted 765
3 SASI_Rn01_00050855 predicted 965
4 SASI_Rn01_00050857 predicted 800
5 SASI_Rn01_00050858 predicted 930
6 SASI_Rn01_00050859 predicted 453
7 SASI_Rn01_00050860 predicted 588
8 SASI_Rn01_00050861 predicted 1035
9 SASI_Rn01_00050862 predicted 1033
10 SASI_Rn02_00202780 predicted 817
11 SASI_Rn01_00050856 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127863 predicted 600
2 SASI_Mm01_00127864 predicted 713
3 SASI_Mm01_00127865 predicted 909
4 SASI_Mm01_00127866 predicted 921
5 SASI_Mm01_00127868 predicted 877
6 SASI_Mm01_00127869 predicted 397
7 SASI_Mm01_00127870 predicted 888
8 SASI_Mm01_00127871 predicted 880
9 SASI_Mm01_00127872 predicted 977
10 SASI_Mm02_00345266 predicted 941
11 SASI_Mm01_00127867 predicted 775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173475
DCUN1D3 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-896s1c1
Sequence:CCGGCGGTATTGGACCAATGGCTAACTCGAGTTAGCCATTGGTCCAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-978s1c1
Sequence:CCGGCCTTAACTTCACTCAGGTGATCTCGAGATCACCTGAGTGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-963s1c1
Sequence:CCGGCACTTGGAACATGTTCCTTAACTCGAGTTAAGGAACATGTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-504s1c1
Sequence:CCGGGCAAAGATTGGAAGAACTGTTCTCGAGAACAGTTCTTCCAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-745s1c1
Sequence:CCGGCTCTTAACAGAAGCCAAACAACTCGAGTTGTTTGGCTTCTGTTAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-1039s1c1
Sequence:CCGGCCAAGTCTCTTTGACACCTTTCTCGAGAAAGGTGTCAAAGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-882s1c1
Sequence:CCGGCCAGAACAATCCTCCGGTATTCTCGAGAATACCGGAGGATTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173475.2-740s21c1
Sequence:CCGGTGCATCGGGAAATAGCCATTGCTCGAGCAATGGCTATTTCCCGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173475.2-1477s21c1
Sequence:CCGGCAGATCTCAGTTTCGCATATTCTCGAGAATATGCGAAACTGAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173475
DCUN1D3 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-896s1c1
Sequence:CCGGCGGTATTGGACCAATGGCTAACTCGAGTTAGCCATTGGTCCAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-978s1c1
Sequence:CCGGCCTTAACTTCACTCAGGTGATCTCGAGATCACCTGAGTGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-963s1c1
Sequence:CCGGCACTTGGAACATGTTCCTTAACTCGAGTTAAGGAACATGTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-504s1c1
Sequence:CCGGGCAAAGATTGGAAGAACTGTTCTCGAGAACAGTTCTTCCAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-745s1c1
Sequence:CCGGCTCTTAACAGAAGCCAAACAACTCGAGTTGTTTGGCTTCTGTTAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-1039s1c1
Sequence:CCGGCCAAGTCTCTTTGACACCTTTCTCGAGAAAGGTGTCAAAGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-882s1c1
Sequence:CCGGCCAGAACAATCCTCCGGTATTCTCGAGAATACCGGAGGATTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173475.2-740s21c1
Sequence:CCGGTGCATCGGGAAATAGCCATTGCTCGAGCAATGGCTATTTCCCGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173475.2-1477s21c1
Sequence:CCGGCAGATCTCAGTTTCGCATATTCTCGAGAATATGCGAAACTGAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173475
DCUN1D3 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-896s1c1
Sequence:CCGGCGGTATTGGACCAATGGCTAACTCGAGTTAGCCATTGGTCCAATACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-978s1c1
Sequence:CCGGCCTTAACTTCACTCAGGTGATCTCGAGATCACCTGAGTGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-963s1c1
Sequence:CCGGCACTTGGAACATGTTCCTTAACTCGAGTTAAGGAACATGTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-504s1c1
Sequence:CCGGGCAAAGATTGGAAGAACTGTTCTCGAGAACAGTTCTTCCAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-745s1c1
Sequence:CCGGCTCTTAACAGAAGCCAAACAACTCGAGTTGTTTGGCTTCTGTTAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173475.1-1039s1c1
Sequence:CCGGCCAAGTCTCTTTGACACCTTTCTCGAGAAAGGTGTCAAAGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173475.1-882s1c1
Sequence:CCGGCCAGAACAATCCTCCGGTATTCTCGAGAATACCGGAGGATTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173475.2-740s21c1
Sequence:CCGGTGCATCGGGAAATAGCCATTGCTCGAGCAATGGCTATTTCCCGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173475.2-1477s21c1
Sequence:CCGGCAGATCTCAGTTTCGCATATTCTCGAGAATATGCGAAACTGAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173408
VALIDATED
DCUN1D3 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173408.1-1631s1c1
Sequence:CCGGGCTGTTTACATGGTTGAATTTCTCGAGAAATTCAACCATGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173408.1-1803s1c1
Sequence:CCGGCCGTCCCTTTAAGCTAATTTACTCGAGTAAATTAGCTTAAAGGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173408.1-1056s1c1
Sequence:CCGGGCCGAGTCTCTTTGATACCTTCTCGAGAAGGTATCAAAGAGACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-793s21c1
Sequence:CCGGTCAAGGATCTCTACCGGTTTACTCGAGTAAACCGGTAGAGATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-1250s21c1
Sequence:CCGGTTACTGAAGATCCGGATATTTCTCGAGAAATATCCGGATCTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-917s21c1
Sequence:CCGGATTGGACCAGTGGCTAAATTTCTCGAGAAATTTAGCCACTGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-848s21c1
Sequence:CCGGGCGGTCACTGCATCGTGAAATCTCGAGATTTCACGATGCAGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-556s21c1
Sequence:CCGGATGAGCGGGAGGATGCAATTTCTCGAGAAATTGCATCCTCCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173408
VALIDATED
DCUN1D3 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173408.1-1631s1c1
Sequence:CCGGGCTGTTTACATGGTTGAATTTCTCGAGAAATTCAACCATGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173408.1-1803s1c1
Sequence:CCGGCCGTCCCTTTAAGCTAATTTACTCGAGTAAATTAGCTTAAAGGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173408.1-1056s1c1
Sequence:CCGGGCCGAGTCTCTTTGATACCTTCTCGAGAAGGTATCAAAGAGACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-793s21c1
Sequence:CCGGTCAAGGATCTCTACCGGTTTACTCGAGTAAACCGGTAGAGATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-1250s21c1
Sequence:CCGGTTACTGAAGATCCGGATATTTCTCGAGAAATATCCGGATCTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-917s21c1
Sequence:CCGGATTGGACCAGTGGCTAAATTTCTCGAGAAATTTAGCCACTGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-848s21c1
Sequence:CCGGGCGGTCACTGCATCGTGAAATCTCGAGATTTCACGATGCAGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-556s21c1
Sequence:CCGGATGAGCGGGAGGATGCAATTTCTCGAGAAATTGCATCCTCCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173408
VALIDATED
DCUN1D3 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173408.1-1631s1c1
Sequence:CCGGGCTGTTTACATGGTTGAATTTCTCGAGAAATTCAACCATGTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173408.1-1803s1c1
Sequence:CCGGCCGTCCCTTTAAGCTAATTTACTCGAGTAAATTAGCTTAAAGGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173408.1-1056s1c1
Sequence:CCGGGCCGAGTCTCTTTGATACCTTCTCGAGAAGGTATCAAAGAGACTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-793s21c1
Sequence:CCGGTCAAGGATCTCTACCGGTTTACTCGAGTAAACCGGTAGAGATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243521    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-1250s21c1
Sequence:CCGGTTACTGAAGATCCGGATATTTCTCGAGAAATATCCGGATCTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-917s21c1
Sequence:CCGGATTGGACCAGTGGCTAAATTTCTCGAGAAATTTAGCCACTGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-848s21c1
Sequence:CCGGGCGGTCACTGCATCGTGAAATCTCGAGATTTCACGATGCAGTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173408.2-556s21c1
Sequence:CCGGATGAGCGGGAGGATGCAATTTCTCGAGAAATTGCATCCTCCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks