EMAIL THIS PAGE TO A FRIEND

DCUN1D4

DCN1, defective in cullin neddylation 1, domain containing 4

292 Gene Product Result for
UniProtKB ID: Q92564, Q7Z3F3, Q7Z6B8
Gene ID:
Mouse(100737) DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Rat(360928) DCN1, defective in cullin neddylation 1, domain containing 4
sheep(101113593) DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
naked mole-rat(101705774) DCN1, defective in cullin neddylation 1, domain containing 4
domestic guinea pig(100722822) DCN1, defective in cullin neddylation 1, domain containing 4
Zebrafish(556765) DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
chicken(422762) DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
dog(611020) DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
cow(538195) DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
domestic cat(101093933) DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015115 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040402 Rosetta Predictions human pricing
NM_015115 Rosetta Predictions human pricing
NM_001108359 Rosetta Predictions rat pricing
NM_178896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195133 predicted 1194
2 SASI_Hs01_00195134 predicted 1065
3 SASI_Hs01_00195135 predicted 1073
4 SASI_Hs01_00195136 predicted 208
5 SASI_Hs01_00195137 predicted 367
6 SASI_Hs01_00195138 predicted 1460
7 SASI_Hs02_00308940 predicted 343
8 SASI_Hs01_00195139 predicted 225
9 SASI_Hs01_00195140 predicted 199
10 SASI_Hs01_00195141 predicted 1448
11 SASI_Hs01_00195142 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049474 predicted 1086
2 SASI_Hs01_00049475 predicted 959
3 SASI_Hs01_00049476 predicted 966
4 SASI_Hs01_00049477 predicted 209
5 SASI_Hs01_00049478 predicted 369
6 SASI_Hs01_00049479 predicted 1356
7 SASI_Hs02_00347015 predicted 343
8 SASI_Hs01_00049480 predicted 224
9 SASI_Hs01_00049481 predicted 202
10 SASI_Hs01_00049482 predicted 1348
11 SASI_Hs01_00049483 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237889 predicted 331
2 SASI_Rn02_00237890 predicted 653
3 SASI_Rn02_00237891 predicted 972
4 SASI_Rn02_00237892 predicted 1006
5 SASI_Rn02_00237893 predicted 323
6 SASI_Rn02_00237894 predicted 814
7 SASI_Rn02_00237895 predicted 279
8 SASI_Rn02_00237896 predicted 620
9 SASI_Rn02_00237897 predicted 1021
10 SASI_Rn02_00237898 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099323 predicted 726
2 SASI_Mm01_00099324 predicted 981
3 SASI_Mm01_00099326 predicted 667
4 SASI_Mm01_00099327 predicted 675
5 SASI_Mm01_00099328 predicted 852
6 SASI_Mm01_00099329 predicted 924
7 SASI_Mm01_00099330 predicted 997
8 SASI_Mm02_00349494 predicted 647
9 SASI_Mm01_00099331 predicted 819
10 SASI_Mm01_00099332 predicted 615
11 SASI_Mm01_00099325 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178896
DCUN1D4 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178896.2-2477s1c1
Sequence:CCGGCCGCTGTTTCACAGTTCCTTTCTCGAGAAAGGAACTGTGAAACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-583s1c1
Sequence:CCGGCTTCCCTACAATGTGATACAACTCGAGTTGTATCACATTGTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-238s1c1
Sequence:CCGGGCAGTTCTTCGGACTGCTTTACTCGAGTAAAGCAGTCCGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-668s1c1
Sequence:CCGGGCTCATTTACAGATACGCGTTCTCGAGAACGCGTATCTGTAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-325s1c1
Sequence:CCGGGCAGGCATGACAGCATGTATACTCGAGTATACATGCTGTCATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-924s1c1
Sequence:CCGGGACGAATTTGTGGAATGGTATCTCGAGATACCATTCCACAAATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-165s1c1
Sequence:CCGGCATACCCTTAACAAGCTGAATCTCGAGATTCAGCTTGTTAAGGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178896
DCUN1D4 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178896.2-2477s1c1
Sequence:CCGGCCGCTGTTTCACAGTTCCTTTCTCGAGAAAGGAACTGTGAAACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-583s1c1
Sequence:CCGGCTTCCCTACAATGTGATACAACTCGAGTTGTATCACATTGTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-238s1c1
Sequence:CCGGGCAGTTCTTCGGACTGCTTTACTCGAGTAAAGCAGTCCGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-668s1c1
Sequence:CCGGGCTCATTTACAGATACGCGTTCTCGAGAACGCGTATCTGTAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-325s1c1
Sequence:CCGGGCAGGCATGACAGCATGTATACTCGAGTATACATGCTGTCATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-924s1c1
Sequence:CCGGGACGAATTTGTGGAATGGTATCTCGAGATACCATTCCACAAATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-165s1c1
Sequence:CCGGCATACCCTTAACAAGCTGAATCTCGAGATTCAGCTTGTTAAGGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178896
DCUN1D4 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178896.2-2477s1c1
Sequence:CCGGCCGCTGTTTCACAGTTCCTTTCTCGAGAAAGGAACTGTGAAACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-583s1c1
Sequence:CCGGCTTCCCTACAATGTGATACAACTCGAGTTGTATCACATTGTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-238s1c1
Sequence:CCGGGCAGTTCTTCGGACTGCTTTACTCGAGTAAAGCAGTCCGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178896.2-668s1c1
Sequence:CCGGGCTCATTTACAGATACGCGTTCTCGAGAACGCGTATCTGTAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-325s1c1
Sequence:CCGGGCAGGCATGACAGCATGTATACTCGAGTATACATGCTGTCATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-924s1c1
Sequence:CCGGGACGAATTTGTGGAATGGTATCTCGAGATACCATTCCACAAATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178896.2-165s1c1
Sequence:CCGGCATACCCTTAACAAGCTGAATCTCGAGATTCAGCTTGTTAAGGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015115
VALIDATED
DCUN1D4 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015115.1-1678s1c1
Sequence:CCGGGCATTCTTCTAGCCAGTGATTCTCGAGAATCACTGGCTAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015115.1-1491s1c1
Sequence:CCGGGCCACAAATCATTTCTACCATCTCGAGATGGTAGAAATGATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015115.1-1333s1c1
Sequence:CCGGGCCAGAATTAACCTTACTGTTCTCGAGAACAGTAAGGTTAATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015115.1-500s1c1
Sequence:CCGGGACATTGGTGTTGAACCAGAACTCGAGTTCTGGTTCAACACCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015115.1-3558s1c1
Sequence:CCGGGCCTCAAACATCCACTGTAATCTCGAGATTACAGTGGATGTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015115.1-542s1c1
Sequence:CCGGGCTTGGAAATTGGATGCACAACTCGAGTTGTGCATCCAATTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015115.1-606s1c1
Sequence:CCGGCTTCTCTCCAATGTGATACAACTCGAGTTGTATCACATTGGAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015115.1-949s1c1
Sequence:CCGGGCTGTTTGTATCAAAGCGCATCTCGAGATGCGCTTTGATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015115.1-800s1c1
Sequence:CCGGCTCAGCAACTATGATGAAGATCTCGAGATCTTCATCATAGTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015115
VALIDATED
DCUN1D4 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015115.1-1678s1c1
Sequence:CCGGGCATTCTTCTAGCCAGTGATTCTCGAGAATCACTGGCTAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015115.1-1491s1c1
Sequence:CCGGGCCACAAATCATTTCTACCATCTCGAGATGGTAGAAATGATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015115.1-1333s1c1
Sequence:CCGGGCCAGAATTAACCTTACTGTTCTCGAGAACAGTAAGGTTAATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015115.1-500s1c1
Sequence:CCGGGACATTGGTGTTGAACCAGAACTCGAGTTCTGGTTCAACACCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015115.1-3558s1c1
Sequence:CCGGGCCTCAAACATCCACTGTAATCTCGAGATTACAGTGGATGTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015115.1-542s1c1
Sequence:CCGGGCTTGGAAATTGGATGCACAACTCGAGTTGTGCATCCAATTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015115.1-606s1c1
Sequence:CCGGCTTCTCTCCAATGTGATACAACTCGAGTTGTATCACATTGGAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015115.1-949s1c1
Sequence:CCGGGCTGTTTGTATCAAAGCGCATCTCGAGATGCGCTTTGATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015115.1-800s1c1
Sequence:CCGGCTCAGCAACTATGATGAAGATCTCGAGATCTTCATCATAGTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015115
VALIDATED
DCUN1D4 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015115.1-1678s1c1
Sequence:CCGGGCATTCTTCTAGCCAGTGATTCTCGAGAATCACTGGCTAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015115.1-1491s1c1
Sequence:CCGGGCCACAAATCATTTCTACCATCTCGAGATGGTAGAAATGATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015115.1-1333s1c1
Sequence:CCGGGCCAGAATTAACCTTACTGTTCTCGAGAACAGTAAGGTTAATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015115.1-500s1c1
Sequence:CCGGGACATTGGTGTTGAACCAGAACTCGAGTTCTGGTTCAACACCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015115.1-3558s1c1
Sequence:CCGGGCCTCAAACATCCACTGTAATCTCGAGATTACAGTGGATGTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015115.1-542s1c1
Sequence:CCGGGCTTGGAAATTGGATGCACAACTCGAGTTGTGCATCCAATTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015115.1-606s1c1
Sequence:CCGGCTTCTCTCCAATGTGATACAACTCGAGTTGTATCACATTGGAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_015115.1-949s1c1
Sequence:CCGGGCTGTTTGTATCAAAGCGCATCTCGAGATGCGCTTTGATACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015115.1-800s1c1
Sequence:CCGGCTCAGCAACTATGATGAAGATCTCGAGATCTTCATCATAGTTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks