EMAIL THIS PAGE TO A FRIEND

DCUN1D5

DCN1, defective in cullin neddylation 1, domain containing 5

71 Gene Product Result for
UniProtKB ID: Q9BTE7, Q3ZTT2
Gene ID:
Mouse(76863) DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
Rat(315405) DCN1, defective in cullin neddylation 1, domain containing 5
Zebrafish(406622) DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
chicken(418980) DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
domestic cat(101084730) DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
cow(508759) DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
dog(487862) DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
domestic guinea pig(100728820) DCN1, defective in cullin neddylation 1, domain containing 5
naked mole-rat(101698649) DCN1, defective in cullin neddylation 1, domain containing 5
sheep(101118636) DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032299 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032299 Rosetta Predictions human pricing
NM_001009696 Rosetta Predictions rat pricing
NM_029775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202687 predicted 823
2 SASI_Hs01_00202688 predicted 592
3 SASI_Hs01_00202689 predicted 729
4 SASI_Hs01_00202690 predicted 871
5 SASI_Hs01_00202691 predicted 406
6 SASI_Hs02_00359636 predicted 827
7 SASI_Hs01_00202692 predicted 721
8 SASI_Hs01_00202693 predicted 576
9 SASI_Hs01_00202694 predicted 775
10 SASI_Hs01_00202696 predicted 844
11 SASI_Hs01_00202695 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113021 predicted 787
2 SASI_Rn01_00113022 predicted 555
3 SASI_Rn01_00113023 predicted 548
4 SASI_Rn02_00199755 predicted 409
5 SASI_Rn01_00113024 predicted 383
6 SASI_Rn01_00113025 predicted 708
7 SASI_Rn01_00113026 predicted 826
8 SASI_Rn01_00113027 predicted 817
9 SASI_Rn02_00199756 predicted 701
10 SASI_Rn01_00113028 predicted 620
11 SASI_Rn01_00113029 predicted 526
12 SASI_Rn01_00113030 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147752 predicted 777
2 SASI_Mm01_00147753 predicted 272
3 SASI_Mm01_00147754 predicted 532
4 SASI_Mm01_00147755 predicted 400
5 SASI_Mm01_00147756 predicted 375
6 SASI_Mm01_00147757 predicted 554
7 SASI_Mm01_00147758 predicted 618
8 SASI_Mm02_00335917 predicted 795
9 SASI_Mm01_00147761 predicted 710
10 SASI_Mm02_00335918 predicted 804
11 SASI_Mm01_00147759 predicted 587
12 SASI_Mm01_00147760 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032299
DCUN1D5 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032299.2-443s1c1
Sequence:CCGGGCAGGTCCTGATGAAGTTGTACTCGAGTACAACTTCATCAGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-437s1c1
Sequence:CCGGGAATATGCAGGTCCTGATGAACTCGAGTTCATCAGGACCTGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-652s1c1
Sequence:CCGGGCGCTCACAGTTGAATGATATCTCGAGATATCATTCAACTGTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032299.2-1023s1c1
Sequence:CCGGCGTGTATACAAGCTAATGTGACTCGAGTCACATTAGCTTGTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032299.2-1009s1c1
Sequence:CCGGCCTTTCAATTCCCACGTGTATCTCGAGATACACGTGGGAATTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-889s1c1
Sequence:CCGGCCATGCTGATCTTAGTAACTACTCGAGTAGTTACTAAGATCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032299.2-1019s1c1
Sequence:CCGGCCCACGTGTATACAAGCTAATCTCGAGATTAGCTTGTATACACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-941s1c1
Sequence:CCGGGATGAATTTGTTGAGTGGCAACTCGAGTTGCCACTCAACAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032299.3-1493s21c1
Sequence:CCGGTATAGTCATCTCTGCACAATTCTCGAGAATTGTGCAGAGATGACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032299.3-1317s21c1
Sequence:CCGGATTTGTGACAAAGGCCTTAAACTCGAGTTTAAGGCCTTTGTCACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-812s21c1
Sequence:CCGGCTTGATATTGATACTGCTAAACTCGAGTTTAGCAGTATCAATATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-921s21c1
Sequence:CCGGACAAAGATCAATGGTACAATGCTCGAGCATTGTACCATTGATCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-898s21c1
Sequence:CCGGGCAATCAAAGTATCGTGTTATCTCGAGATAACACGATACTTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032299
DCUN1D5 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032299.2-443s1c1
Sequence:CCGGGCAGGTCCTGATGAAGTTGTACTCGAGTACAACTTCATCAGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-437s1c1
Sequence:CCGGGAATATGCAGGTCCTGATGAACTCGAGTTCATCAGGACCTGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-652s1c1
Sequence:CCGGGCGCTCACAGTTGAATGATATCTCGAGATATCATTCAACTGTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032299.2-1023s1c1
Sequence:CCGGCGTGTATACAAGCTAATGTGACTCGAGTCACATTAGCTTGTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032299.2-1009s1c1
Sequence:CCGGCCTTTCAATTCCCACGTGTATCTCGAGATACACGTGGGAATTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-889s1c1
Sequence:CCGGCCATGCTGATCTTAGTAACTACTCGAGTAGTTACTAAGATCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032299.2-1019s1c1
Sequence:CCGGCCCACGTGTATACAAGCTAATCTCGAGATTAGCTTGTATACACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-941s1c1
Sequence:CCGGGATGAATTTGTTGAGTGGCAACTCGAGTTGCCACTCAACAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032299.3-1493s21c1
Sequence:CCGGTATAGTCATCTCTGCACAATTCTCGAGAATTGTGCAGAGATGACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032299.3-1317s21c1
Sequence:CCGGATTTGTGACAAAGGCCTTAAACTCGAGTTTAAGGCCTTTGTCACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-812s21c1
Sequence:CCGGCTTGATATTGATACTGCTAAACTCGAGTTTAGCAGTATCAATATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-921s21c1
Sequence:CCGGACAAAGATCAATGGTACAATGCTCGAGCATTGTACCATTGATCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-898s21c1
Sequence:CCGGGCAATCAAAGTATCGTGTTATCTCGAGATAACACGATACTTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032299
DCUN1D5 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032299.2-443s1c1
Sequence:CCGGGCAGGTCCTGATGAAGTTGTACTCGAGTACAACTTCATCAGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-437s1c1
Sequence:CCGGGAATATGCAGGTCCTGATGAACTCGAGTTCATCAGGACCTGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-652s1c1
Sequence:CCGGGCGCTCACAGTTGAATGATATCTCGAGATATCATTCAACTGTGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032299.2-1023s1c1
Sequence:CCGGCGTGTATACAAGCTAATGTGACTCGAGTCACATTAGCTTGTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032299.2-1009s1c1
Sequence:CCGGCCTTTCAATTCCCACGTGTATCTCGAGATACACGTGGGAATTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-889s1c1
Sequence:CCGGCCATGCTGATCTTAGTAACTACTCGAGTAGTTACTAAGATCAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032299.2-1019s1c1
Sequence:CCGGCCCACGTGTATACAAGCTAATCTCGAGATTAGCTTGTATACACGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032299.2-941s1c1
Sequence:CCGGGATGAATTTGTTGAGTGGCAACTCGAGTTGCCACTCAACAAATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032299.3-1493s21c1
Sequence:CCGGTATAGTCATCTCTGCACAATTCTCGAGAATTGTGCAGAGATGACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032299.3-1317s21c1
Sequence:CCGGATTTGTGACAAAGGCCTTAAACTCGAGTTTAAGGCCTTTGTCACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-812s21c1
Sequence:CCGGCTTGATATTGATACTGCTAAACTCGAGTTTAGCAGTATCAATATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-921s21c1
Sequence:CCGGACAAAGATCAATGGTACAATGCTCGAGCATTGTACCATTGATCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032299.3-898s21c1
Sequence:CCGGGCAATCAAAGTATCGTGTTATCTCGAGATAACACGATACTTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029775
VALIDATED
DCUN1D5 MISSION shRNA Bacterial Glycerol Stock
DCN1, defective in cullin neddylation 1, domain containing 5
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029775.1-1002s1c1
Sequence:CCGGGAGTACAGAAAGGGTGCATTTCTCGAGAAATGCACCCTTTCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-814s1c1
Sequence:CCGGGATCAGTGGTACAATGTATTACTCGAGTAATACATTGTACCACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-654s1c1
Sequence:CCGGCTACAGATATGCCTTTGATTTCTCGAGAAATCAAAGGCATATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029775.1-1035s1c1
Sequence:CCGGGACTTCTCATAGTACTTCTTTCTCGAGAAAGAAGTACTATGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-620s1c1
Sequence:CCGGCTCAGCTGAATGACATCTCATCTCGAGATGAGATGTCATTCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029775.1-709s1c1
Sequence:CCGGGATACTGCGAAGTCTATGTTACTCGAGTAACATAGACTTCGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-549s1c1
Sequence:CCGGGTTAAAGGGAATGACCTCATTCTCGAGAATGAGGTCATTCCCTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-371s1c1
Sequence:CCGGCAAGAAAGAAGTGCCTGGCTTCTCGAGAAGCCAGGCACTTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-499s1c1
Sequence:CCGGGCATGGAAATTGGAGGCTGAACTCGAGTTCAGCCTCCAATTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029775.1-956s1c1
Sequence:CCGGCGTGAAGACAATGCAAACCTTCTCGAGAAGGTTTGCATTGTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-534s21c1
Sequence:CCGGTACCAAGGAAGAATGGTTAAACTCGAGTTTAACCATTCTTCCTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-786s21c1
Sequence:CCGGGCAATCAAAGTATCGTGTTATCTCGAGATAACACGATACTTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-706s21c1
Sequence:CCGGATTGATACTGCGAAGTCTATGCTCGAGCATAGACTTCGCAGTATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-892s21c1
Sequence:CCGGCCTGTTCTTCTTGATGAATTTCTCGAGAAATTCATCAAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-956s21c1
Sequence:CCGGCGTGAAGACAATGCAAACCTTCTCGAGAAGGTTTGCATTGTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029775
VALIDATED
DCUN1D5 MISSION shRNA shRNA Plasmid DNA
DCN1, defective in cullin neddylation 1, domain containing 5
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029775.1-1002s1c1
Sequence:CCGGGAGTACAGAAAGGGTGCATTTCTCGAGAAATGCACCCTTTCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-814s1c1
Sequence:CCGGGATCAGTGGTACAATGTATTACTCGAGTAATACATTGTACCACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-654s1c1
Sequence:CCGGCTACAGATATGCCTTTGATTTCTCGAGAAATCAAAGGCATATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029775.1-1035s1c1
Sequence:CCGGGACTTCTCATAGTACTTCTTTCTCGAGAAAGAAGTACTATGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-620s1c1
Sequence:CCGGCTCAGCTGAATGACATCTCATCTCGAGATGAGATGTCATTCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029775.1-709s1c1
Sequence:CCGGGATACTGCGAAGTCTATGTTACTCGAGTAACATAGACTTCGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-549s1c1
Sequence:CCGGGTTAAAGGGAATGACCTCATTCTCGAGAATGAGGTCATTCCCTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-371s1c1
Sequence:CCGGCAAGAAAGAAGTGCCTGGCTTCTCGAGAAGCCAGGCACTTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-499s1c1
Sequence:CCGGGCATGGAAATTGGAGGCTGAACTCGAGTTCAGCCTCCAATTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029775.1-956s1c1
Sequence:CCGGCGTGAAGACAATGCAAACCTTCTCGAGAAGGTTTGCATTGTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-534s21c1
Sequence:CCGGTACCAAGGAAGAATGGTTAAACTCGAGTTTAACCATTCTTCCTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-786s21c1
Sequence:CCGGGCAATCAAAGTATCGTGTTATCTCGAGATAACACGATACTTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-706s21c1
Sequence:CCGGATTGATACTGCGAAGTCTATGCTCGAGCATAGACTTCGCAGTATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-892s21c1
Sequence:CCGGCCTGTTCTTCTTGATGAATTTCTCGAGAAATTCATCAAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-956s21c1
Sequence:CCGGCGTGAAGACAATGCAAACCTTCTCGAGAAGGTTTGCATTGTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029775
VALIDATED
DCUN1D5 MISSION shRNA Lentiviral Transduction Particles
DCN1, defective in cullin neddylation 1, domain containing 5
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029775.1-1002s1c1
Sequence:CCGGGAGTACAGAAAGGGTGCATTTCTCGAGAAATGCACCCTTTCTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-814s1c1
Sequence:CCGGGATCAGTGGTACAATGTATTACTCGAGTAATACATTGTACCACTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-654s1c1
Sequence:CCGGCTACAGATATGCCTTTGATTTCTCGAGAAATCAAAGGCATATCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029775.1-1035s1c1
Sequence:CCGGGACTTCTCATAGTACTTCTTTCTCGAGAAAGAAGTACTATGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-620s1c1
Sequence:CCGGCTCAGCTGAATGACATCTCATCTCGAGATGAGATGTCATTCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029775.1-709s1c1
Sequence:CCGGGATACTGCGAAGTCTATGTTACTCGAGTAACATAGACTTCGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-549s1c1
Sequence:CCGGGTTAAAGGGAATGACCTCATTCTCGAGAATGAGGTCATTCCCTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029775.1-371s1c1
Sequence:CCGGCAAGAAAGAAGTGCCTGGCTTCTCGAGAAGCCAGGCACTTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029775.1-499s1c1
Sequence:CCGGGCATGGAAATTGGAGGCTGAACTCGAGTTCAGCCTCCAATTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029775.1-956s1c1
Sequence:CCGGCGTGAAGACAATGCAAACCTTCTCGAGAAGGTTTGCATTGTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-534s21c1
Sequence:CCGGTACCAAGGAAGAATGGTTAAACTCGAGTTTAACCATTCTTCCTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-786s21c1
Sequence:CCGGGCAATCAAAGTATCGTGTTATCTCGAGATAACACGATACTTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-706s21c1
Sequence:CCGGATTGATACTGCGAAGTCTATGCTCGAGCATAGACTTCGCAGTATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-892s21c1
Sequence:CCGGCCTGTTCTTCTTGATGAATTTCTCGAGAAATTCATCAAGAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029775.2-956s21c1
Sequence:CCGGCGTGAAGACAATGCAAACCTTCTCGAGAAGGTTTGCATTGTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks