EMAIL THIS PAGE TO A FRIEND

DCX

doublecortin

394 Gene Product Result for
Synonyms: DBCN DC LISX SCLH XLIS
Gene ID:
Human(1641) Summary: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase, and this interaction is important to proper microtubule function in the developing cortex. Mutations in this gene cause abnormal migration of neurons during development and disrupt the layering of the cortex, leading to epilepsy, mental retardation, subcortical band heterotopia ('double cortex' syndrome) in females and lissencephaly ('smooth brain' syndrome) in males. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(13193) doublecortin
Rat(84394) doublecortin
sheep(101109861) doublecortin
chicken(374242) doublecortin
domestic cat(494212) doublecortin
cow(787968) doublecortin
Horse(100058909) doublecortin
dog(612950) doublecortin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41333 Anti-DCX (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, human, bovine, horse, rat, mouse, rabbit
western blot pricing
AV41332 Anti-DCX (AB2) antibody produced in rabbit affinity isolated antibody human, mouse, horse
western blot pricing
SAB2502091 Anti-Dcx antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
SAB2501666 Anti-DCX antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, bovine, mouse, canine, pig, human
ELISA, immunohistochemistry, western blot pricing
SAB1405701 Anti-DCX antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA059243 Anti-DCX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA036121 Anti-DCX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
D9818 Anti-Doublecortin (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
D9943 Anti-Doublecortin (N-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
D9693 Anti-Doublecortin antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB4300697 Anti-Doublecortin antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4500628 Anti-Doublecortin antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4500629 Anti-Doublecortin, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504028 Anti-phospho-Doublecortin (pSer297) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
WH0001641M1 Monoclonal Anti-DCX antibody produced in mouse clone 1G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403727 Monoclonal Anti-DCX antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000555 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067021 MISSION® esiRNA esiRNA human DCX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000555 Rosetta Predictions human pricing
NM_178151 Rosetta Predictions human pricing
NM_178152 Rosetta Predictions human pricing
NM_178153 Rosetta Predictions human pricing
NM_053379 Rosetta Predictions rat pricing
NM_001110222 Rosetta Predictions mouse pricing
NM_001110223 Rosetta Predictions mouse pricing
NM_001110224 Rosetta Predictions mouse pricing
NM_010025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049035 predicted 730
2 SASI_Hs02_00302801 predicted 1577
3 SASI_Hs01_00049037 predicted 713
4 SASI_Hs01_00049038 predicted 1031
5 SASI_Hs01_00049039 predicted 1115
6 SASI_Hs01_00049040 predicted 886
7 SASI_Hs01_00049041 predicted 838
8 SASI_Hs01_00049042 predicted 669
9 SASI_Hs01_00049043 predicted 1047
10 SASI_Hs01_00049044 predicted 1544
11 SASI_Hs01_00049036 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234638 predicted 440
2 SASI_Hs02_00369556 predicted 1293
3 SASI_Hs01_00234640 predicted 426
4 SASI_Hs01_00234641 predicted 746
5 SASI_Hs01_00234642 predicted 828
6 SASI_Hs01_00234643 predicted 602
7 SASI_Hs01_00234644 predicted 559
8 SASI_Hs01_00234645 predicted 384
9 SASI_Hs01_00234646 predicted 758
10 SASI_Hs01_00234647 predicted 1263
11 SASI_Hs01_00234639 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073110 predicted 370
2 SASI_Hs02_00369557 predicted 1240
3 SASI_Hs01_00073112 predicted 359
4 SASI_Hs01_00073113 predicted 684
5 SASI_Hs01_00073114 predicted 759
6 SASI_Hs01_00073115 predicted 535
7 SASI_Hs01_00073116 predicted 486
8 SASI_Hs01_00073117 predicted 314
9 SASI_Hs01_00073118 predicted 695
10 SASI_Hs01_00073119 predicted 1208
11 SASI_Hs01_00073111 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025124 predicted 374
2 SASI_Hs02_00369558 predicted 1219
3 SASI_Hs01_00025126 predicted 362
4 SASI_Hs01_00025127 predicted 683
5 SASI_Hs01_00025128 predicted 761
6 SASI_Hs01_00025129 predicted 539
7 SASI_Hs01_00025130 predicted 486
8 SASI_Hs01_00025131 predicted 314
9 SASI_Hs01_00025132 predicted 691
10 SASI_Hs01_00025133 predicted 1189
11 SASI_Hs01_00025125 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070400 predicted 1107
2 SASI_Rn01_00070401 predicted 1114
3 SASI_Rn01_00070402 predicted 811
4 SASI_Rn01_00070403 predicted 1157
5 SASI_Rn01_00070404 predicted 966
6 SASI_Rn01_00070405 predicted 647
7 SASI_Rn02_00265864 predicted 651
8 SASI_Rn01_00070406 predicted 1065
9 SASI_Rn01_00070408 predicted 1040
10 SASI_Rn01_00070409 predicted 770
11 SASI_Rn01_00070407 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305016 predicted 1511
2 SASI_Mm02_00305017 predicted 1517
3 SASI_Mm02_00305018 predicted 1746
4 SASI_Mm02_00305019 predicted 1716
5 SASI_Mm02_00305020 predicted 1508
6 SASI_Mm02_00305021 predicted 1794
7 SASI_Mm02_00305022 predicted 457
8 SASI_Mm02_00305023 predicted 1803
9 SASI_Mm02_00305024 predicted 1589
10 SASI_Mm02_00305025 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305026 predicted 1439
2 SASI_Mm02_00305027 predicted 1437
3 SASI_Mm02_00305028 predicted 1670
4 SASI_Mm02_00305029 predicted 1636
5 SASI_Mm02_00305030 predicted 1422
6 SASI_Mm02_00305031 predicted 1716
7 SASI_Mm02_00305032 predicted 382
8 SASI_Mm02_00305033 predicted 1729
9 SASI_Mm02_00305034 predicted 1508
10 SASI_Mm02_00305035 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305036 predicted 1433
2 SASI_Mm02_00305037 predicted 1441
3 SASI_Mm02_00305038 predicted 1660
4 SASI_Mm02_00305039 predicted 1630
5 SASI_Mm02_00305040 predicted 1427
6 SASI_Mm02_00305041 predicted 1714
7 SASI_Mm02_00305042 predicted 377
8 SASI_Mm02_00305043 predicted 1728
9 SASI_Mm02_00305044 predicted 1510
10 SASI_Mm02_00305045 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317666 predicted 1413
2 SASI_Mm02_00317667 predicted 1420
3 SASI_Mm02_00317668 predicted 1648
4 SASI_Mm02_00317669 predicted 1621
5 SASI_Mm02_00317670 predicted 1408
6 SASI_Mm02_00317671 predicted 1707
7 SASI_Mm01_00025561 predicted 374
8 SASI_Mm02_00317672 predicted 1710
9 SASI_Mm02_00317673 predicted 1499
10 SASI_Mm02_00317674 predicted 1419
11 SASI_Mm01_00025558 predicted 627
12 SASI_Mm01_00025559 predicted 1218
13 SASI_Mm01_00025560 predicted 1263
14 SASI_Mm01_00025562 predicted 382
15 SASI_Mm01_00025563 predicted 256
16 SASI_Mm01_00025564 predicted 828
17 SASI_Mm01_00025565 predicted 827
18 SASI_Mm01_00025566 predicted 1231
19 SASI_Mm01_00025567 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000555
DCX MISSION shRNA Bacterial Glycerol Stock
doublecortin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000555.2-1786s21c1
Sequence:CCGGCTTAGGTGCCTGCGTTATATTCTCGAGAATATAACGCAGGCACCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000555.2-795s21c1
Sequence:CCGGGTTCCTCAGACAACTTCTTTACTCGAGTAAAGAAGTTGTCTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000555.2-1685s21c1
Sequence:CCGGGATCCACAGTTACCAATTATGCTCGAGCATAATTGGTAACTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000555.2-1120s21c1
Sequence:CCGCGGTAACTTGTCTCCATGATTTCTCGAGAAATCATGGAGACAAGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-846s1c1
Sequence:CCGGCCAACTGGTCTGTCAACGTAACTCGAGTTACGTTGACAGACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000555.2-8907s1c1
Sequence:CCGGGCCACCTATTTAGAATAGTTACTCGAGTAACTATTCTAAATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-548s1c1
Sequence:CCGGGCACTGAGTAATGAGAAGAAACTCGAGTTTCTTCTCATTACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-360s1c1
Sequence:CCGGGCCCGAAGTTCCAATTTGATACTCGAGTATCAAATTGGAACTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-716s1c1
Sequence:CCGGGTGCGTTACATTTACACCATTCTCGAGAATGGTGTAAATGTAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000555
DCX MISSION shRNA shRNA Plasmid DNA
doublecortin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000555.2-1786s21c1
Sequence:CCGGCTTAGGTGCCTGCGTTATATTCTCGAGAATATAACGCAGGCACCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000555.2-795s21c1
Sequence:CCGGGTTCCTCAGACAACTTCTTTACTCGAGTAAAGAAGTTGTCTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000555.2-1685s21c1
Sequence:CCGGGATCCACAGTTACCAATTATGCTCGAGCATAATTGGTAACTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000555.2-1120s21c1
Sequence:CCGCGGTAACTTGTCTCCATGATTTCTCGAGAAATCATGGAGACAAGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-846s1c1
Sequence:CCGGCCAACTGGTCTGTCAACGTAACTCGAGTTACGTTGACAGACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000555.2-8907s1c1
Sequence:CCGGGCCACCTATTTAGAATAGTTACTCGAGTAACTATTCTAAATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-548s1c1
Sequence:CCGGGCACTGAGTAATGAGAAGAAACTCGAGTTTCTTCTCATTACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-360s1c1
Sequence:CCGGGCCCGAAGTTCCAATTTGATACTCGAGTATCAAATTGGAACTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-716s1c1
Sequence:CCGGGTGCGTTACATTTACACCATTCTCGAGAATGGTGTAAATGTAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000555
DCX MISSION shRNA Lentiviral Transduction Particles
doublecortin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000555.2-1786s21c1
Sequence:CCGGCTTAGGTGCCTGCGTTATATTCTCGAGAATATAACGCAGGCACCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000555.2-795s21c1
Sequence:CCGGGTTCCTCAGACAACTTCTTTACTCGAGTAAAGAAGTTGTCTGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000555.2-1685s21c1
Sequence:CCGGGATCCACAGTTACCAATTATGCTCGAGCATAATTGGTAACTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000555.2-1120s21c1
Sequence:CCGCGGTAACTTGTCTCCATGATTTCTCGAGAAATCATGGAGACAAGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-846s1c1
Sequence:CCGGCCAACTGGTCTGTCAACGTAACTCGAGTTACGTTGACAGACCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000555.2-8907s1c1
Sequence:CCGGGCCACCTATTTAGAATAGTTACTCGAGTAACTATTCTAAATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-548s1c1
Sequence:CCGGGCACTGAGTAATGAGAAGAAACTCGAGTTTCTTCTCATTACTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-360s1c1
Sequence:CCGGGCCCGAAGTTCCAATTTGATACTCGAGTATCAAATTGGAACTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000555.2-716s1c1
Sequence:CCGGGTGCGTTACATTTACACCATTCTCGAGAATGGTGTAAATGTAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010025
DCX MISSION shRNA Bacterial Glycerol Stock
doublecortin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010025.2-7934s1c1
Sequence:CCGGCGGCTGTAATTGGTGGTTGTACTCGAGTACAACCACCAATTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-758s1c1
Sequence:CCGGCGCGTGCTTCTCAACAAGAAACTCGAGTTTCTTGTTGAGAAGCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-707s1c1
Sequence:CCGGCCCAAACTTGTGACCATCATTCTCGAGAATGATGGTCACAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-301s1c1
Sequence:CCGGGCAGGCATTAAGTAATGAGAACTCGAGTTCTCATTACTTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-942s1c1
Sequence:CCGGTCCGCTATGCTCAAGATGATTCTCGAGAATCATCTTGAGCATAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010025
DCX MISSION shRNA shRNA Plasmid DNA
doublecortin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010025.2-7934s1c1
Sequence:CCGGCGGCTGTAATTGGTGGTTGTACTCGAGTACAACCACCAATTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-758s1c1
Sequence:CCGGCGCGTGCTTCTCAACAAGAAACTCGAGTTTCTTGTTGAGAAGCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-707s1c1
Sequence:CCGGCCCAAACTTGTGACCATCATTCTCGAGAATGATGGTCACAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-301s1c1
Sequence:CCGGGCAGGCATTAAGTAATGAGAACTCGAGTTCTCATTACTTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-942s1c1
Sequence:CCGGTCCGCTATGCTCAAGATGATTCTCGAGAATCATCTTGAGCATAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010025
DCX MISSION shRNA Lentiviral Transduction Particles
doublecortin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010025.2-7934s1c1
Sequence:CCGGCGGCTGTAATTGGTGGTTGTACTCGAGTACAACCACCAATTACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-758s1c1
Sequence:CCGGCGCGTGCTTCTCAACAAGAAACTCGAGTTTCTTGTTGAGAAGCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-707s1c1
Sequence:CCGGCCCAAACTTGTGACCATCATTCTCGAGAATGATGGTCACAAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-301s1c1
Sequence:CCGGGCAGGCATTAAGTAATGAGAACTCGAGTTCTCATTACTTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010025.2-942s1c1
Sequence:CCGGTCCGCTATGCTCAAGATGATTCTCGAGAATCATCTTGAGCATAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks