EMAIL THIS PAGE TO A FRIEND

DCXR

dicarbonyl/L-xylulose reductase

51 Gene Product Result for
Synonyms: DCR HCR2 HCRII KIDCR P34H SDR20C1 XR
UniProtKB ID: Q7Z4W1, Q9BTZ3, Q9UHY9
Gene ID:
Human(51181) Summary: The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Mouse(67880) dicarbonyl L-xylulose reductase
Rat(171408) dicarbonyl L-xylulose reductase
Zebrafish(550282) dicarbonyl/L-xylulose reductase
cow(526937) dicarbonyl/L-xylulose reductase
cow(782391) L-xylulose reductase-like
domestic cat(101091167) dicarbonyl/L-xylulose reductase
dog(475926) dicarbonyl/L-xylulose reductase
chicken(374066) dicarbonyl/L-xylulose reductase
domestic guinea pig(100135515) dicarbonyl L-xylulose reductase
domestic guinea pig(100712804) dicarbonyl/L-xylulose reductase
naked mole-rat(101724611) dicarbonyl/L-xylulose reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016286 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021591 MISSION® esiRNA esiRNA human DCXR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016286 Rosetta Predictions human pricing
NM_134387 Rosetta Predictions rat pricing
NM_026428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201997 predicted 336
2 SASI_Hs01_00201998 predicted 316
3 SASI_Hs01_00201999 predicted 515
4 SASI_Hs01_00202000 predicted 340
5 SASI_Hs01_00202002 predicted 294
6 SASI_Hs01_00202003 predicted 400
7 SASI_Hs01_00202004 predicted 527
8 SASI_Hs01_00202005 predicted 312
9 SASI_Hs02_00349205 predicted 430
10 SASI_Hs02_00349206 predicted 455
11 SASI_Hs01_00202001 predicted 559
12 SASI_Hs01_00202006 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064199 predicted 602
2 SASI_Rn01_00064200 predicted 591
3 SASI_Rn01_00064201 predicted 586
4 SASI_Rn01_00064202 predicted 586
5 SASI_Rn01_00064203 predicted 579
6 SASI_Rn01_00064204 predicted 586
7 SASI_Rn01_00064205 predicted 600
8 SASI_Rn01_00064206 predicted 588
9 SASI_Rn01_00064207 predicted 597
10 SASI_Rn01_00064208 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330240 predicted 511
2 SASI_Mm01_00172946 predicted 641
3 SASI_Mm01_00172947 predicted 394
4 SASI_Mm01_00172949 predicted 515
5 SASI_Mm01_00172950 predicted 250
6 SASI_Mm01_00172951 predicted 597
7 SASI_Mm02_00330241 predicted 687
8 SASI_Mm01_00172952 predicted 348
9 SASI_Mm01_00172953 predicted 476
10 SASI_Mm01_00172954 predicted 426
11 SASI_Mm01_00172948 predicted 384
12 SASI_Mm01_00172955 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026428
VALIDATED
DCXR MISSION shRNA Bacterial Glycerol Stock
dicarbonyl/L-xylulose reductase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-564s1c1
Sequence:CCGGGATCCGTGTGAATGCAGTAAACTCGAGTTTACTGCATTCACACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-346s1c1
Sequence:CCGGGCCTGTGACACATCCTTCAATCTCGAGATTGAAGGATGTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026428.1-693s1c1
Sequence:CCGGCGTCGTGGACACCATTCTCTTCTCGAGAAGAGAATGGTGTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-482s1c1
Sequence:CCGGCCAACCATACTGTCTACTGTTCTCGAGAACAGTAGACAGTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-382s1c1
Sequence:CCGGGTCATCCAGGTGTCTCAGATTCTCGAGAATCTGAGACACCTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-383s21c2
Sequence:CCGGGTCATCCAGGTGTCTCAGATTCTCGAGAATCTGAGACACCTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-565s21c2
Sequence:CCGGGATCCGTGTGAATGCAGTAAACTCGAGTTTACTGCATTCACACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-694s21c2
Sequence:CCGGCGTCGTGGACACCATTCTCTTCTCGAGAAGAGAATGGTGTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-483s21c3
Sequence:CCGGCCAACCATACTGTCTACTGTTCTCGAGAACAGTAGACAGTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-347s21c2
Sequence:CCGGGCCTGTGACACATCCTTCAATCTCGAGATTGAAGGATGTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026428
VALIDATED
DCXR MISSION shRNA shRNA Plasmid DNA
dicarbonyl/L-xylulose reductase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-564s1c1
Sequence:CCGGGATCCGTGTGAATGCAGTAAACTCGAGTTTACTGCATTCACACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-346s1c1
Sequence:CCGGGCCTGTGACACATCCTTCAATCTCGAGATTGAAGGATGTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026428.1-693s1c1
Sequence:CCGGCGTCGTGGACACCATTCTCTTCTCGAGAAGAGAATGGTGTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-482s1c1
Sequence:CCGGCCAACCATACTGTCTACTGTTCTCGAGAACAGTAGACAGTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-382s1c1
Sequence:CCGGGTCATCCAGGTGTCTCAGATTCTCGAGAATCTGAGACACCTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-383s21c2
Sequence:CCGGGTCATCCAGGTGTCTCAGATTCTCGAGAATCTGAGACACCTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-565s21c2
Sequence:CCGGGATCCGTGTGAATGCAGTAAACTCGAGTTTACTGCATTCACACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-694s21c2
Sequence:CCGGCGTCGTGGACACCATTCTCTTCTCGAGAAGAGAATGGTGTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-483s21c3
Sequence:CCGGCCAACCATACTGTCTACTGTTCTCGAGAACAGTAGACAGTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-347s21c2
Sequence:CCGGGCCTGTGACACATCCTTCAATCTCGAGATTGAAGGATGTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026428
VALIDATED
DCXR MISSION shRNA Lentiviral Transduction Particles
dicarbonyl/L-xylulose reductase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-564s1c1
Sequence:CCGGGATCCGTGTGAATGCAGTAAACTCGAGTTTACTGCATTCACACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-346s1c1
Sequence:CCGGGCCTGTGACACATCCTTCAATCTCGAGATTGAAGGATGTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026428.1-693s1c1
Sequence:CCGGCGTCGTGGACACCATTCTCTTCTCGAGAAGAGAATGGTGTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-482s1c1
Sequence:CCGGCCAACCATACTGTCTACTGTTCTCGAGAACAGTAGACAGTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026428.1-382s1c1
Sequence:CCGGGTCATCCAGGTGTCTCAGATTCTCGAGAATCTGAGACACCTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-383s21c2
Sequence:CCGGGTCATCCAGGTGTCTCAGATTCTCGAGAATCTGAGACACCTGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-565s21c2
Sequence:CCGGGATCCGTGTGAATGCAGTAAACTCGAGTTTACTGCATTCACACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-694s21c2
Sequence:CCGGCGTCGTGGACACCATTCTCTTCTCGAGAAGAGAATGGTGTCCACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-483s21c3
Sequence:CCGGCCAACCATACTGTCTACTGTTCTCGAGAACAGTAGACAGTATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026428.2-347s21c2
Sequence:CCGGGCCTGTGACACATCCTTCAATCTCGAGATTGAAGGATGTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016286
VALIDATED
DCXR MISSION shRNA Bacterial Glycerol Stock
dicarbonyl/L-xylulose reductase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016286.2-622s1c1
Sequence:CCGGCGAATCCCACTTGGCAAGTTTCTCGAGAAACTTGCCAAGTGGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016286.2-434s1c1
Sequence:CCGGAGCGGGCAGTAACTAACCATACTCGAGTATGGTTAGTTACTGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-528s1c1
Sequence:CCGGGATCCGAGTGAATGCAGTAAACTCGAGTTTACTGCATTCACTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-136s1c1
Sequence:CCGGCAGGCGGATCTTGACAGCCTTCTCGAGAAGGCTGTCAAGATCCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-605s1c1
Sequence:CCGGCCAAGACTATGCTGAACCGAACTCGAGTTCGGTTCAGCATAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016286.2-434s21c1
Sequence:CCGGAGCGGGCAGTAACTAACCATACTCGAGTATGGTTAGTTACTGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016286.2-605s21c1
Sequence:CCGGCCAAGACTATGCTGAACCGAACTCGAGTTCGGTTCAGCATAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016286.2-528s21c1
Sequence:CCGGGATCCGAGTGAATGCAGTAAACTCGAGTTTACTGCATTCACTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016286.2-622s21c1
Sequence:CCGGCGAATCCCACTTGGCAAGTTTCTCGAGAAACTTGCCAAGTGGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016286
VALIDATED
DCXR MISSION shRNA shRNA Plasmid DNA
dicarbonyl/L-xylulose reductase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016286.2-622s1c1
Sequence:CCGGCGAATCCCACTTGGCAAGTTTCTCGAGAAACTTGCCAAGTGGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016286.2-434s1c1
Sequence:CCGGAGCGGGCAGTAACTAACCATACTCGAGTATGGTTAGTTACTGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-528s1c1
Sequence:CCGGGATCCGAGTGAATGCAGTAAACTCGAGTTTACTGCATTCACTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-136s1c1
Sequence:CCGGCAGGCGGATCTTGACAGCCTTCTCGAGAAGGCTGTCAAGATCCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-605s1c1
Sequence:CCGGCCAAGACTATGCTGAACCGAACTCGAGTTCGGTTCAGCATAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016286.2-434s21c1
Sequence:CCGGAGCGGGCAGTAACTAACCATACTCGAGTATGGTTAGTTACTGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016286.2-605s21c1
Sequence:CCGGCCAAGACTATGCTGAACCGAACTCGAGTTCGGTTCAGCATAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016286.2-528s21c1
Sequence:CCGGGATCCGAGTGAATGCAGTAAACTCGAGTTTACTGCATTCACTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016286.2-622s21c1
Sequence:CCGGCGAATCCCACTTGGCAAGTTTCTCGAGAAACTTGCCAAGTGGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016286
VALIDATED
DCXR MISSION shRNA Lentiviral Transduction Particles
dicarbonyl/L-xylulose reductase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016286.2-622s1c1
Sequence:CCGGCGAATCCCACTTGGCAAGTTTCTCGAGAAACTTGCCAAGTGGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016286.2-434s1c1
Sequence:CCGGAGCGGGCAGTAACTAACCATACTCGAGTATGGTTAGTTACTGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-528s1c1
Sequence:CCGGGATCCGAGTGAATGCAGTAAACTCGAGTTTACTGCATTCACTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-136s1c1
Sequence:CCGGCAGGCGGATCTTGACAGCCTTCTCGAGAAGGCTGTCAAGATCCGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016286.2-605s1c1
Sequence:CCGGCCAAGACTATGCTGAACCGAACTCGAGTTCGGTTCAGCATAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016286.2-434s21c1
Sequence:CCGGAGCGGGCAGTAACTAACCATACTCGAGTATGGTTAGTTACTGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016286.2-605s21c1
Sequence:CCGGCCAAGACTATGCTGAACCGAACTCGAGTTCGGTTCAGCATAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016286.2-528s21c1
Sequence:CCGGGATCCGAGTGAATGCAGTAAACTCGAGTTTACTGCATTCACTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016286.2-622s21c1
Sequence:CCGGCGAATCCCACTTGGCAAGTTTCTCGAGAAACTTGCCAAGTGGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks