EMAIL THIS PAGE TO A FRIEND

DDA1

DET1 and DDB1 associated 1

Synonyms: C19orf58 PCIA1
UniProtKB ID: Q9BW61
Gene ID:
Mouse(66498) DET1 and DDB1 associated 1
Rat(688813) DET1 and DDB1 associated 1
Zebrafish(796589) DET1 and DDB1 associated 1
chicken(426942) DET1 and DDB1 associated 1
dog(476675) DET1 and DDB1 associated 1
domestic cat(101096792) DET1 and DDB1 associated 1
cow(512898) DET1 and DDB1 associated 1
sheep(101112562) DET1 and DDB1 associated 1
naked mole-rat(101719507) DET1 and DDB1 associated 1
domestic guinea pig(100732730) DET1 and DDB1 associated 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024050 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098411 MISSION® esiRNA esiRNA human DDA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024050 Rosetta Predictions human pricing
NM_001134790 Rosetta Predictions rat pricing
NM_025600 Rosetta Predictions mouse pricing
XM_980302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237256 predicted 411
2 SASI_Hs01_00237257 predicted 560
3 SASI_Hs01_00237258 predicted 234
4 SASI_Hs01_00237260 predicted 558
5 SASI_Hs01_00237261 predicted 245
6 SASI_Hs01_00237262 predicted 546
7 SASI_Hs01_00237263 predicted 564
8 SASI_Hs01_00237264 predicted 247
9 SASI_Hs01_00237265 predicted 314
10 SASI_Hs02_00356494 predicted 407
11 SASI_Hs01_00237259 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258524 predicted 888
2 SASI_Rn02_00258525 predicted 545
3 SASI_Rn02_00258526 predicted 595
4 SASI_Rn02_00258527 predicted 807
5 SASI_Rn02_00258528 predicted 254
6 SASI_Rn02_00258529 predicted 226
7 SASI_Rn02_00258530 predicted 126
8 SASI_Rn02_00258531 predicted 180
9 SASI_Rn02_00258532 predicted 542
10 SASI_Rn02_00258533 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328605 predicted 624
2 SASI_Mm02_00328606 predicted 530
3 SASI_Mm02_00328607 predicted 524
4 SASI_Mm02_00328608 predicted 281
5 SASI_Mm02_00328609 predicted 684
6 SASI_Mm02_00328610 predicted 244
7 SASI_Mm02_00328611 predicted 935
8 SASI_Mm02_00328612 predicted 936
9 SASI_Mm02_00328613 predicted 624
10 SASI_Mm02_00328614 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242445 predicted 535
2 SASI_Mm01_00242446 predicted 633
3 SASI_Mm01_00242447 predicted 540
4 SASI_Mm01_00242448 predicted 630
5 SASI_Mm01_00242449 predicted 528
6 SASI_Mm01_00242450 predicted 590
7 SASI_Mm01_00242451 predicted 599
8 SASI_Mm01_00242452 predicted 292
9 SASI_Mm01_00242453 predicted 690
10 SASI_Mm01_00242454 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024050
VALIDATED
DDA1 MISSION shRNA Bacterial Glycerol Stock
DET1 and DDB1 associated 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-175s21c1
Sequence:CCGGTAGTCGATTTCACGCGGACTCCTCGAGGAGTCCGCGTGAAATCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-571s21c1
Sequence:CCGGCCTCATAGGAGCCGATGTATTCTCGAGAATACATCGGCTCCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024050.5-257s21c1
Sequence:CCGGGAACAGATCATCGTGACAGAACTCGAGTTCTGTCACGATGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-302s21c1
Sequence:CCGGCTGCATCAGCAATGGGACAAACTCGAGTTTGTCCCATTGCTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-416s21c1
Sequence:CCGGGACATGCACGAGGACACTTAACTCGAGTTAAGTGTCCTCGTGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024050.3-233s1c1
Sequence:CCGGGACAAACATCCTCCTGCGCTACTCGAGTAGCGCAGGAGGATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024050.4-611s1c1
Sequence:CCGGCTGTAACCTGTATCAAGCGTTCTCGAGAACGCTTGATACAGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024050.4-246s1c1
Sequence:CCGGCGTCTGAACAGATCATCGTGACTCGAGTCACGATGATCTGTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024050
VALIDATED
DDA1 MISSION shRNA shRNA Plasmid DNA
DET1 and DDB1 associated 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-175s21c1
Sequence:CCGGTAGTCGATTTCACGCGGACTCCTCGAGGAGTCCGCGTGAAATCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-571s21c1
Sequence:CCGGCCTCATAGGAGCCGATGTATTCTCGAGAATACATCGGCTCCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024050.5-257s21c1
Sequence:CCGGGAACAGATCATCGTGACAGAACTCGAGTTCTGTCACGATGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-302s21c1
Sequence:CCGGCTGCATCAGCAATGGGACAAACTCGAGTTTGTCCCATTGCTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-416s21c1
Sequence:CCGGGACATGCACGAGGACACTTAACTCGAGTTAAGTGTCCTCGTGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024050.3-233s1c1
Sequence:CCGGGACAAACATCCTCCTGCGCTACTCGAGTAGCGCAGGAGGATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024050.4-611s1c1
Sequence:CCGGCTGTAACCTGTATCAAGCGTTCTCGAGAACGCTTGATACAGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024050.4-246s1c1
Sequence:CCGGCGTCTGAACAGATCATCGTGACTCGAGTCACGATGATCTGTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024050
VALIDATED
DDA1 MISSION shRNA Lentiviral Transduction Particles
DET1 and DDB1 associated 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-175s21c1
Sequence:CCGGTAGTCGATTTCACGCGGACTCCTCGAGGAGTCCGCGTGAAATCGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-571s21c1
Sequence:CCGGCCTCATAGGAGCCGATGTATTCTCGAGAATACATCGGCTCCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024050.5-257s21c1
Sequence:CCGGGAACAGATCATCGTGACAGAACTCGAGTTCTGTCACGATGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-302s21c1
Sequence:CCGGCTGCATCAGCAATGGGACAAACTCGAGTTTGTCCCATTGCTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024050.5-416s21c1
Sequence:CCGGGACATGCACGAGGACACTTAACTCGAGTTAAGTGTCCTCGTGCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024050.3-233s1c1
Sequence:CCGGGACAAACATCCTCCTGCGCTACTCGAGTAGCGCAGGAGGATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024050.4-611s1c1
Sequence:CCGGCTGTAACCTGTATCAAGCGTTCTCGAGAACGCTTGATACAGGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024050.4-246s1c1
Sequence:CCGGCGTCTGAACAGATCATCGTGACTCGAGTCACGATGATCTGTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025600
VALIDATED
DDA1 MISSION shRNA Bacterial Glycerol Stock
DET1 and DDB1 associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025600.1-584s21c1
Sequence:CCGGCTCGTGTCAAGCATTGGTTAACTCGAGTTAACCAATGCTTGACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-333s21c1
Sequence:CCGGTGCCAAGAAGAGAGACCAAGACTCGAGTCTTGGTCTCTCTTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025600.1-304s21c1
Sequence:CCGGCTGCACCAGCAATGGGATAAACTCGAGTTTATCCCATTGCTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-251s21c1
Sequence:CCGGACCCGTCAGAACAGATCATTGCTCGAGCAATGATCTGTTCTGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-158s21c1
Sequence:CCGGTCTACAACAAGAGCAACTTCACTCGAGTGAAGTTGCTCTTGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025600
VALIDATED
DDA1 MISSION shRNA shRNA Plasmid DNA
DET1 and DDB1 associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025600.1-584s21c1
Sequence:CCGGCTCGTGTCAAGCATTGGTTAACTCGAGTTAACCAATGCTTGACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-333s21c1
Sequence:CCGGTGCCAAGAAGAGAGACCAAGACTCGAGTCTTGGTCTCTCTTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025600.1-304s21c1
Sequence:CCGGCTGCACCAGCAATGGGATAAACTCGAGTTTATCCCATTGCTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-251s21c1
Sequence:CCGGACCCGTCAGAACAGATCATTGCTCGAGCAATGATCTGTTCTGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-158s21c1
Sequence:CCGGTCTACAACAAGAGCAACTTCACTCGAGTGAAGTTGCTCTTGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025600
VALIDATED
DDA1 MISSION shRNA Lentiviral Transduction Particles
DET1 and DDB1 associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025600.1-584s21c1
Sequence:CCGGCTCGTGTCAAGCATTGGTTAACTCGAGTTAACCAATGCTTGACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-333s21c1
Sequence:CCGGTGCCAAGAAGAGAGACCAAGACTCGAGTCTTGGTCTCTCTTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025600.1-304s21c1
Sequence:CCGGCTGCACCAGCAATGGGATAAACTCGAGTTTATCCCATTGCTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-251s21c1
Sequence:CCGGACCCGTCAGAACAGATCATTGCTCGAGCAATGATCTGTTCTGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025600.1-158s21c1
Sequence:CCGGTCTACAACAAGAGCAACTTCACTCGAGTGAAGTTGCTCTTGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks