EMAIL THIS PAGE TO A FRIEND

DDAH2

dimethylarginine dimethylaminohydrolase 2

76 Gene Product Result for
Synonyms: DDAH DDAHII G6a NG30
UniProtKB ID: O95865, A2BEZ7
Gene ID:
Human(23564) Summary: This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]
Mouse(51793) dimethylarginine dimethylaminohydrolase 2
Rat(294239) dimethylarginine dimethylaminohydrolase 2
Zebrafish(799954) dimethylarginine dimethylaminohydrolase 2
cow(540386) dimethylarginine dimethylaminohydrolase 2
domestic cat(101089769) dimethylarginine dimethylaminohydrolase 2
dog(474846) dimethylarginine dimethylaminohydrolase 2
sheep(101118391) dimethylarginine dimethylaminohydrolase 2
naked mole-rat(101703578) dimethylarginine dimethylaminohydrolase 2
domestic guinea pig(100720724) dimethylarginine dimethylaminohydrolase 2
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013974 Rosetta Predictions human pricing
NM_212532 Rosetta Predictions rat pricing
XM_579741 Rosetta Predictions rat pricing
NM_016765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140647 predicted 638
2 SASI_Hs01_00140649 predicted 739
3 SASI_Hs01_00140651 predicted 869
4 SASI_Hs01_00140652 predicted 604
5 SASI_Hs01_00140653 predicted 568
6 SASI_Hs01_00140654 predicted 657
7 SASI_Hs01_00140655 predicted 527
8 SASI_Hs02_00344919 predicted 377
9 SASI_Hs02_00344920 predicted 451
10 SASI_Hs02_00344921 predicted 616
11 SASI_Hs01_00140648 predicted 716
12 SASI_Hs01_00140650 predicted 1021
13 SASI_Hs01_00140656 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270555 predicted 670
2 SASI_Rn01_00034825 predicted 359
3 SASI_Rn01_00034827 predicted 366
4 SASI_Rn01_00034828 predicted 531
5 SASI_Rn01_00034829 predicted 392
6 SASI_Rn01_00034830 predicted 461
7 SASI_Rn01_00034831 predicted 694
8 SASI_Rn01_00034832 predicted 483
9 SASI_Rn01_00034833 predicted 1018
10 SASI_Rn01_00034834 predicted 355
11 SASI_Rn01_00034826 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170855 predicted 344
2 SASI_Rn01_00170856 predicted 208
3 SASI_Rn01_00170857 predicted 269
4 SASI_Rn01_00170858 predicted 674
5 SASI_Rn01_00170859 predicted 500
6 SASI_Rn01_00170860 predicted 298
7 SASI_Rn01_00170861 predicted 827
8 SASI_Rn01_00170862 predicted 285
9 SASI_Rn01_00170863 predicted 499
10 SASI_Rn01_00170864 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087167 predicted 876
2 SASI_Mm01_00087168 predicted 366
3 SASI_Mm02_00323526 predicted 855
4 SASI_Mm01_00087169 predicted 368
5 SASI_Mm01_00087170 predicted 866
6 SASI_Mm01_00087171 predicted 522
7 SASI_Mm01_00087172 predicted 555
8 SASI_Mm01_00087173 predicted 480
9 SASI_Mm01_00087174 predicted 258
10 SASI_Mm01_00087175 predicted 454
11 SASI_Mm01_00087176 predicted 525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013974
DDAH2 MISSION shRNA Bacterial Glycerol Stock
dimethylarginine dimethylaminohydrolase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013974.1-648s21c1
Sequence:CCGGGGATGGCACTGACGTTCTCTTCTCGAGAAGAGAACGTCAGTGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013974.1-384s21c1
Sequence:CCGGGGATCTGGCCAAAGCTCAAAGCTCGAGCTTTGAGCTTTGGCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013974.1-1200s21c1
Sequence:CCGGGTTAGATAGAGAATGCTGAATCTCGAGATTCAGCATTCTCTATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013974.1-1168s21c1
Sequence:CCGGAGGATAGTATAGGAAGTAGAACTCGAGTTCTACTTCCTATACTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-877s1c1
Sequence:CCGGGTGCTGACAGATCACCCATATCTCGAGATATGGGTGATCTGTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-936s1c1
Sequence:CCGGCCTCTTTCTTCGTCCTGGGTTCTCGAGAACCCAGGACGAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-1030s1c1
Sequence:CCGGCTCTCTGATGTCACCCTGGTACTCGAGTACCAGGGTGACATCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-453s1c1
Sequence:CCGGGCTGCTAGAACTGCCACCTGACTCGAGTCAGGTGGCAGTTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-618s1c1
Sequence:CCGGTGTGGAAATAGGAGACGAGAACTCGAGTTCTCGTCTCCTATTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013974
DDAH2 MISSION shRNA shRNA Plasmid DNA
dimethylarginine dimethylaminohydrolase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013974.1-648s21c1
Sequence:CCGGGGATGGCACTGACGTTCTCTTCTCGAGAAGAGAACGTCAGTGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013974.1-384s21c1
Sequence:CCGGGGATCTGGCCAAAGCTCAAAGCTCGAGCTTTGAGCTTTGGCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013974.1-1200s21c1
Sequence:CCGGGTTAGATAGAGAATGCTGAATCTCGAGATTCAGCATTCTCTATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013974.1-1168s21c1
Sequence:CCGGAGGATAGTATAGGAAGTAGAACTCGAGTTCTACTTCCTATACTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-877s1c1
Sequence:CCGGGTGCTGACAGATCACCCATATCTCGAGATATGGGTGATCTGTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-936s1c1
Sequence:CCGGCCTCTTTCTTCGTCCTGGGTTCTCGAGAACCCAGGACGAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-1030s1c1
Sequence:CCGGCTCTCTGATGTCACCCTGGTACTCGAGTACCAGGGTGACATCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-453s1c1
Sequence:CCGGGCTGCTAGAACTGCCACCTGACTCGAGTCAGGTGGCAGTTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-618s1c1
Sequence:CCGGTGTGGAAATAGGAGACGAGAACTCGAGTTCTCGTCTCCTATTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013974
DDAH2 MISSION shRNA Lentiviral Transduction Particles
dimethylarginine dimethylaminohydrolase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013974.1-648s21c1
Sequence:CCGGGGATGGCACTGACGTTCTCTTCTCGAGAAGAGAACGTCAGTGCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013974.1-384s21c1
Sequence:CCGGGGATCTGGCCAAAGCTCAAAGCTCGAGCTTTGAGCTTTGGCCAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013974.1-1200s21c1
Sequence:CCGGGTTAGATAGAGAATGCTGAATCTCGAGATTCAGCATTCTCTATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013974.1-1168s21c1
Sequence:CCGGAGGATAGTATAGGAAGTAGAACTCGAGTTCTACTTCCTATACTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-877s1c1
Sequence:CCGGGTGCTGACAGATCACCCATATCTCGAGATATGGGTGATCTGTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-936s1c1
Sequence:CCGGCCTCTTTCTTCGTCCTGGGTTCTCGAGAACCCAGGACGAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-1030s1c1
Sequence:CCGGCTCTCTGATGTCACCCTGGTACTCGAGTACCAGGGTGACATCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-453s1c1
Sequence:CCGGGCTGCTAGAACTGCCACCTGACTCGAGTCAGGTGGCAGTTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013974.1-618s1c1
Sequence:CCGGTGTGGAAATAGGAGACGAGAACTCGAGTTCTCGTCTCCTATTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016765
VALIDATED
DDAH2 MISSION shRNA Bacterial Glycerol Stock
dimethylarginine dimethylaminohydrolase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016765.1-1102s1c1
Sequence:CCGGGAGCTGTATAGTGGGTAGAATCTCGAGATTCTACCCACTATACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-880s1c1
Sequence:CCGGGCAGCTAGTGACTGTCTCTTTCTCGAGAAAGAGACAGTCACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-349s1c1
Sequence:CCGGGCTAAAGCTCAAAGGGAGCATCTCGAGATGCTCCCTTTGAGCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-528s1c1
Sequence:CCGGTGAGGTTGATGGAGTGCGTAACTCGAGTTACGCACTCCATCAACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-477s1c1
Sequence:CCGGCCAAGGAGACACGGCCCTAATCTCGAGATTAGGGCCGTGTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016765
VALIDATED
DDAH2 MISSION shRNA shRNA Plasmid DNA
dimethylarginine dimethylaminohydrolase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016765.1-1102s1c1
Sequence:CCGGGAGCTGTATAGTGGGTAGAATCTCGAGATTCTACCCACTATACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-880s1c1
Sequence:CCGGGCAGCTAGTGACTGTCTCTTTCTCGAGAAAGAGACAGTCACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-349s1c1
Sequence:CCGGGCTAAAGCTCAAAGGGAGCATCTCGAGATGCTCCCTTTGAGCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-528s1c1
Sequence:CCGGTGAGGTTGATGGAGTGCGTAACTCGAGTTACGCACTCCATCAACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-477s1c1
Sequence:CCGGCCAAGGAGACACGGCCCTAATCTCGAGATTAGGGCCGTGTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016765
VALIDATED
DDAH2 MISSION shRNA Lentiviral Transduction Particles
dimethylarginine dimethylaminohydrolase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016765.1-1102s1c1
Sequence:CCGGGAGCTGTATAGTGGGTAGAATCTCGAGATTCTACCCACTATACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-880s1c1
Sequence:CCGGGCAGCTAGTGACTGTCTCTTTCTCGAGAAAGAGACAGTCACTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-349s1c1
Sequence:CCGGGCTAAAGCTCAAAGGGAGCATCTCGAGATGCTCCCTTTGAGCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-528s1c1
Sequence:CCGGTGAGGTTGATGGAGTGCGTAACTCGAGTTACGCACTCCATCAACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016765.1-477s1c1
Sequence:CCGGCCAAGGAGACACGGCCCTAATCTCGAGATTAGGGCCGTGTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks