EMAIL THIS PAGE TO A FRIEND

DDB1

damage-specific DNA binding protein 1, 127kDa

Synonyms: DDBA UV-DDB1 XAP1 XPCE XPE XPE-BF
UniProtKB ID: Q16531, A6NG77, B2R648, O15176, Q13289, Q58F96
Gene ID:
Human(1642) Summary: The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
Mouse(13194) damage specific DNA binding protein 1
Rat(64470) damage-specific DNA binding protein 1, 127kDa
Zebrafish(393599) damage specific DNA binding protein 1
chicken(374050) damage-specific DNA binding protein 1, 127kDa
domestic cat(101081079) damage-specific DNA binding protein 1, 127kDa
cow(511951) damage-specific DNA binding protein 1, 127kDa
Horse(100059606) damage-specific DNA binding protein 1, 127kDa
dog(476067) damage-specific DNA binding protein 1, 127kDa
domestic guinea pig(100724177) damage-specific DNA binding protein 1, 127kDa
naked mole-rat(101712635) damage-specific DNA binding protein 1, 127kDa
sheep(101106122) damage-specific DNA binding protein 1, 127kDa
Domestic Rabbit(100354475) damage-specific DNA binding protein 1, 127kDa
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001923 Rosetta Predictions human pricing
NM_171995 Rosetta Predictions rat pricing
NM_015735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242315 predicted 721
2 SASI_Hs01_00242316 predicted 1587
3 SASI_Hs01_00242318 predicted 3625
4 SASI_Hs02_00332813 predicted 661
5 SASI_Hs01_00242320 predicted 1161
6 SASI_Hs01_00242321 predicted 3562
7 SASI_Hs02_00332814 predicted 675
8 SASI_Hs01_00242322 predicted 648
9 SASI_Hs02_00332815 predicted 870
10 SASI_Hs02_00332816 predicted 1146
11 SASI_Hs01_00242314 predicted 1359
12 SASI_Hs01_00242317 predicted 3376
13 SASI_Hs01_00242319 predicted 914
14 SASI_Hs01_00242323 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050336 predicted 631
2 SASI_Rn01_00050337 predicted 1878
3 SASI_Rn01_00050338 predicted 2364
4 SASI_Rn01_00050339 predicted 1431
5 SASI_Rn01_00050340 predicted 1069
6 SASI_Rn01_00050341 predicted 3472
7 SASI_Rn01_00050342 predicted 564
8 SASI_Rn01_00050343 predicted 2256
9 SASI_Rn01_00050344 predicted 2772
10 SASI_Rn01_00050345 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079214 predicted 3268
2 SASI_Mm01_00079215 predicted 845
3 SASI_Mm01_00079217 predicted 256
4 SASI_Mm01_00079218 predicted 2303
5 SASI_Mm01_00079219 predicted 447
6 SASI_Mm01_00079220 predicted 1941
7 SASI_Mm01_00079221 predicted 2684
8 SASI_Mm01_00079222 predicted 3354
9 SASI_Mm01_00079223 predicted 1548
10 SASI_Mm02_00323061 predicted 571
11 SASI_Mm01_00079216 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015735
VALIDATED
DDB1 MISSION shRNA Bacterial Glycerol Stock
damage-specific DNA binding protein 1, 127kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-767s1c1
Sequence:CCGGCCATCATCATTGGACAGGAATCTCGAGATTCCTGTCCAATGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-336s21c1
Sequence:CCGGTGCCTGTATCTTGGAGTATAACTCGAGTTATACTCCAAGATACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-821s21c1
Sequence:CCGGCAATTGCTCCTCCTATCATTACTCGAGTAATGATAGGAGGAGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-821s1c1
Sequence:CCGGCAATTGCTCCTCCTATCATTACTCGAGTAATGATAGGAGGAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-792s1c1
Sequence:CCGGCACCTATCATAACGGTGATAACTCGAGTTATCACCGTTATGATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-337s1c1
Sequence:CCGGGCCTGTATCTTGGAGTATAAGCTCGAGCTTATACTCCAAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-2198s21c1
Sequence:CCGGAGATCCAGAAGCTCCATATTCCTCGAGGAATATGGAGCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-3748s21c1
Sequence:CCGGTGGACCACCAAGCCTTGAATGCTCGAGCATTCAAGGCTTGGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-1613s21c1
Sequence:CCGGCCGTGGGAAGGGCACTATATTCTCGAGAATATAGTGCCCTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015735
VALIDATED
DDB1 MISSION shRNA shRNA Plasmid DNA
damage-specific DNA binding protein 1, 127kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-767s1c1
Sequence:CCGGCCATCATCATTGGACAGGAATCTCGAGATTCCTGTCCAATGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-336s21c1
Sequence:CCGGTGCCTGTATCTTGGAGTATAACTCGAGTTATACTCCAAGATACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-821s21c1
Sequence:CCGGCAATTGCTCCTCCTATCATTACTCGAGTAATGATAGGAGGAGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-821s1c1
Sequence:CCGGCAATTGCTCCTCCTATCATTACTCGAGTAATGATAGGAGGAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-792s1c1
Sequence:CCGGCACCTATCATAACGGTGATAACTCGAGTTATCACCGTTATGATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-337s1c1
Sequence:CCGGGCCTGTATCTTGGAGTATAAGCTCGAGCTTATACTCCAAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-2198s21c1
Sequence:CCGGAGATCCAGAAGCTCCATATTCCTCGAGGAATATGGAGCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-3748s21c1
Sequence:CCGGTGGACCACCAAGCCTTGAATGCTCGAGCATTCAAGGCTTGGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-1613s21c1
Sequence:CCGGCCGTGGGAAGGGCACTATATTCTCGAGAATATAGTGCCCTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015735
VALIDATED
DDB1 MISSION shRNA Lentiviral Transduction Particles
damage-specific DNA binding protein 1, 127kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-767s1c1
Sequence:CCGGCCATCATCATTGGACAGGAATCTCGAGATTCCTGTCCAATGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-336s21c1
Sequence:CCGGTGCCTGTATCTTGGAGTATAACTCGAGTTATACTCCAAGATACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-821s21c1
Sequence:CCGGCAATTGCTCCTCCTATCATTACTCGAGTAATGATAGGAGGAGCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-821s1c1
Sequence:CCGGCAATTGCTCCTCCTATCATTACTCGAGTAATGATAGGAGGAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-792s1c1
Sequence:CCGGCACCTATCATAACGGTGATAACTCGAGTTATCACCGTTATGATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015735.1-337s1c1
Sequence:CCGGGCCTGTATCTTGGAGTATAAGCTCGAGCTTATACTCCAAGATACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-2198s21c1
Sequence:CCGGAGATCCAGAAGCTCCATATTCCTCGAGGAATATGGAGCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-3748s21c1
Sequence:CCGGTGGACCACCAAGCCTTGAATGCTCGAGCATTCAAGGCTTGGTGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015735.1-1613s21c1
Sequence:CCGGCCGTGGGAAGGGCACTATATTCTCGAGAATATAGTGCCCTTCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001923
VALIDATED
DDB1 MISSION shRNA Bacterial Glycerol Stock
damage-specific DNA binding protein 1, 127kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001923.2-3784s1c1
Sequence:CCGGCCTTGATTGGTGTTGCCAGTTCTCGAGAACTGGCAACACCAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-1981s1c1
Sequence:CCGGCGACCGTAAGAAGGTGACTTTCTCGAGAAAGTCACCTTCTTACGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001923.2-3278s1c1
Sequence:CCGGCGACTCAATAAAGTCATCAAACTCGAGTTTGATGACTTTATTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-2716s1c1
Sequence:CCGGCGTGTACTCTATGGTGGAATTCTCGAGAATTCCACCATAGAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-822s1c1
Sequence:CCGGCCTATCACAATGGTGACAAATCTCGAGATTTGTCACCATTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-2098s21c1
Sequence:CCGGCGACCGTAAGAAGGTGACTTTCTCGAGAAAGTCACCTTCTTACGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001923.3-3901s21c1
Sequence:CCGGCCTTGATTGGTGTTGCCAGTTCTCGAGAACTGGCAACACCAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-2833s21c1
Sequence:CCGGCGTGTACTCTATGGTGGAATTCTCGAGAATTCCACCATAGAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-655s21c1
Sequence:CCGGTCCACTAGATCGCGATAATAACTCGAGTTATTATCGCGATCTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-482s21c1
Sequence:CCGGGCCTGCATCCTGGAGTATAAACTCGAGTTTATACTCCAGGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001923
VALIDATED
DDB1 MISSION shRNA shRNA Plasmid DNA
damage-specific DNA binding protein 1, 127kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001923.2-3784s1c1
Sequence:CCGGCCTTGATTGGTGTTGCCAGTTCTCGAGAACTGGCAACACCAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-1981s1c1
Sequence:CCGGCGACCGTAAGAAGGTGACTTTCTCGAGAAAGTCACCTTCTTACGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001923.2-3278s1c1
Sequence:CCGGCGACTCAATAAAGTCATCAAACTCGAGTTTGATGACTTTATTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-2716s1c1
Sequence:CCGGCGTGTACTCTATGGTGGAATTCTCGAGAATTCCACCATAGAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-822s1c1
Sequence:CCGGCCTATCACAATGGTGACAAATCTCGAGATTTGTCACCATTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-2098s21c1
Sequence:CCGGCGACCGTAAGAAGGTGACTTTCTCGAGAAAGTCACCTTCTTACGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001923.3-3901s21c1
Sequence:CCGGCCTTGATTGGTGTTGCCAGTTCTCGAGAACTGGCAACACCAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-2833s21c1
Sequence:CCGGCGTGTACTCTATGGTGGAATTCTCGAGAATTCCACCATAGAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-655s21c1
Sequence:CCGGTCCACTAGATCGCGATAATAACTCGAGTTATTATCGCGATCTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-482s21c1
Sequence:CCGGGCCTGCATCCTGGAGTATAAACTCGAGTTTATACTCCAGGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001923
VALIDATED
DDB1 MISSION shRNA Lentiviral Transduction Particles
damage-specific DNA binding protein 1, 127kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001923.2-3784s1c1
Sequence:CCGGCCTTGATTGGTGTTGCCAGTTCTCGAGAACTGGCAACACCAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-1981s1c1
Sequence:CCGGCGACCGTAAGAAGGTGACTTTCTCGAGAAAGTCACCTTCTTACGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001923.2-3278s1c1
Sequence:CCGGCGACTCAATAAAGTCATCAAACTCGAGTTTGATGACTTTATTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-2716s1c1
Sequence:CCGGCGTGTACTCTATGGTGGAATTCTCGAGAATTCCACCATAGAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001923.2-822s1c1
Sequence:CCGGCCTATCACAATGGTGACAAATCTCGAGATTTGTCACCATTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-2098s21c1
Sequence:CCGGCGACCGTAAGAAGGTGACTTTCTCGAGAAAGTCACCTTCTTACGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001923.3-3901s21c1
Sequence:CCGGCCTTGATTGGTGTTGCCAGTTCTCGAGAACTGGCAACACCAATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-2833s21c1
Sequence:CCGGCGTGTACTCTATGGTGGAATTCTCGAGAATTCCACCATAGAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-655s21c1
Sequence:CCGGTCCACTAGATCGCGATAATAACTCGAGTTATTATCGCGATCTAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001923.3-482s21c1
Sequence:CCGGGCCTGCATCCTGGAGTATAAACTCGAGTTTATACTCCAGGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks