EMAIL THIS PAGE TO A FRIEND

DDB2

damage-specific DNA binding protein 2, 48kDa

Synonyms: DDBB UV-DDB2
UniProtKB ID: Q92466, B2R875, Q76E54, Q76E55, Q76E56, Q76E57
Gene ID:
Human(1643) Summary: This gene encodes a protein that is necessary for the repair of ultraviolet light-damaged DNA. This protein is the smaller subunit of a heterodimeric protein complex that participates in nucleotide excision repair, and this complex mediates the ubiquitylation of histones H3 and H4, which facilitates the cellular response to DNA damage. This subunit appears to be required for DNA binding. Mutations in this gene cause xeroderma pigmentosum complementation group E, a recessive disease that is characterized by an increased sensitivity to UV light and a high predisposition for skin cancer development, in some cases accompanied by neurological abnormalities. [provided by RefSeq, Jul 2008]
Mouse(107986) damage specific DNA binding protein 2
Rat(100362121) damage specific DNA binding protein 2
Zebrafish(100004133) damage-specific DNA binding protein 2
chicken(423185) damage-specific DNA binding protein 2, 48kDa
Thale Cress(835990) DNA damage-binding protein 2
cow(519357) damage-specific DNA binding protein 2, 48kDa
Horse(100051180) damage-specific DNA binding protein 2, 48kDa
domestic cat(101092211) damage-specific DNA binding protein 2, 48kDa
dog(483626) damage-specific DNA binding protein 2, 48kDa
sheep(101116344) damage-specific DNA binding protein 2, 48kDa
Domestic Rabbit(100352386) damage-specific DNA binding protein 2, 48kDa
naked mole-rat(101715591) damage-specific DNA binding protein 2, 48kDa
domestic guinea pig(100726538) damage-specific DNA binding protein 2, 48kDa
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000107 Rosetta Predictions human pricing
NM_028119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101645 predicted 286
2 SASI_Hs01_00101647 predicted 730
3 SASI_Hs01_00101648 predicted 591
4 SASI_Hs01_00101649 predicted 618
5 SASI_Hs01_00101650 predicted 1328
6 SASI_Hs01_00101651 predicted 671
7 SASI_Hs02_00301882 predicted 1545
8 SASI_Hs01_00101652 predicted 826
9 SASI_Hs01_00101653 predicted 1232
10 SASI_Hs01_00101654 predicted 892
11 SASI_Hs01_00101646 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176820 predicted 1023
2 SASI_Mm02_00333376 predicted 734
3 SASI_Mm01_00176821 predicted 644
4 SASI_Mm01_00176822 predicted 696
5 SASI_Mm01_00176823 predicted 809
6 SASI_Mm01_00176824 predicted 962
7 SASI_Mm01_00176826 predicted 577
8 SASI_Mm01_00176827 predicted 558
9 SASI_Mm01_00176828 predicted 591
10 SASI_Mm02_00333377 predicted 735
11 SASI_Mm01_00176825 predicted 1311
12 SASI_Mm01_00176829 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000107
VALIDATED
DDB2 MISSION shRNA Bacterial Glycerol Stock
damage-specific DNA binding protein 2, 48kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-972s21c1
Sequence:CCGGCACAGCCTCCGTAGATCAAACCTCGAGGTTTGATCTACGGAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000107.2-1547s21c1
Sequence:CCGGCAGAGGTGGCGATTTGTTAAACTCGAGTTTAACAAATCGCCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-1369s21c1
Sequence:CCGGTCTGGCATCAGTTCGCTTAATCTCGAGATTAAGCGAACTGATGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000107.2-1643s21c1
Sequence:CCGGATGTTAATGCTCTGGACTTGCCTCGAGGCAAGTCCAGAGCATTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-227s21c1
Sequence:CCGGAGACCTCCGAGATTGTATTACCTCGAGGTAATACAATCTCGGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-1119s21c1
Sequence:CCGGGAAGAGCGAGATCCGAGTTTACTCGAGTAAACTCGGATCTCGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-736s21c1
Sequence:CCGGACTAGGCTGCAAGACTTTAAACTCGAGTTTAAAGTCTTGCAGCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000107.1-1526s1c1
Sequence:CCGGGCAGAGGTGGTGATTTGTTAACTCGAGTTAACAAATCACCACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000107.1-658s1c1
Sequence:CCGGGCTGAAGTTTAACCCTCTCAACTCGAGTTGAGAGGGTTAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-1211s1c1
Sequence:CCGGCCTCGCTACAACCTCATTGTTCTCGAGAACAATGAGGTTGTAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-466s1c1
Sequence:CCGGTCTGGATTCTTACCGGATATTCTCGAGAATATCCGGTAAGAATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-767s1c1
Sequence:CCGGGACACCATCAACATCTGGTTTCTCGAGAAACCAGATGTTGATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000107
VALIDATED
DDB2 MISSION shRNA shRNA Plasmid DNA
damage-specific DNA binding protein 2, 48kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-972s21c1
Sequence:CCGGCACAGCCTCCGTAGATCAAACCTCGAGGTTTGATCTACGGAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000107.2-1547s21c1
Sequence:CCGGCAGAGGTGGCGATTTGTTAAACTCGAGTTTAACAAATCGCCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-1369s21c1
Sequence:CCGGTCTGGCATCAGTTCGCTTAATCTCGAGATTAAGCGAACTGATGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000107.2-1643s21c1
Sequence:CCGGATGTTAATGCTCTGGACTTGCCTCGAGGCAAGTCCAGAGCATTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-227s21c1
Sequence:CCGGAGACCTCCGAGATTGTATTACCTCGAGGTAATACAATCTCGGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-1119s21c1
Sequence:CCGGGAAGAGCGAGATCCGAGTTTACTCGAGTAAACTCGGATCTCGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-736s21c1
Sequence:CCGGACTAGGCTGCAAGACTTTAAACTCGAGTTTAAAGTCTTGCAGCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000107.1-1526s1c1
Sequence:CCGGGCAGAGGTGGTGATTTGTTAACTCGAGTTAACAAATCACCACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000107.1-658s1c1
Sequence:CCGGGCTGAAGTTTAACCCTCTCAACTCGAGTTGAGAGGGTTAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-1211s1c1
Sequence:CCGGCCTCGCTACAACCTCATTGTTCTCGAGAACAATGAGGTTGTAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-466s1c1
Sequence:CCGGTCTGGATTCTTACCGGATATTCTCGAGAATATCCGGTAAGAATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-767s1c1
Sequence:CCGGGACACCATCAACATCTGGTTTCTCGAGAAACCAGATGTTGATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000107
VALIDATED
DDB2 MISSION shRNA Lentiviral Transduction Particles
damage-specific DNA binding protein 2, 48kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-972s21c1
Sequence:CCGGCACAGCCTCCGTAGATCAAACCTCGAGGTTTGATCTACGGAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000107.2-1547s21c1
Sequence:CCGGCAGAGGTGGCGATTTGTTAAACTCGAGTTTAACAAATCGCCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-1369s21c1
Sequence:CCGGTCTGGCATCAGTTCGCTTAATCTCGAGATTAAGCGAACTGATGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000107.2-1643s21c1
Sequence:CCGGATGTTAATGCTCTGGACTTGCCTCGAGGCAAGTCCAGAGCATTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-227s21c1
Sequence:CCGGAGACCTCCGAGATTGTATTACCTCGAGGTAATACAATCTCGGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-1119s21c1
Sequence:CCGGGAAGAGCGAGATCCGAGTTTACTCGAGTAAACTCGGATCTCGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000107.2-736s21c1
Sequence:CCGGACTAGGCTGCAAGACTTTAAACTCGAGTTTAAAGTCTTGCAGCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000107.1-1526s1c1
Sequence:CCGGGCAGAGGTGGTGATTTGTTAACTCGAGTTAACAAATCACCACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000107.1-658s1c1
Sequence:CCGGGCTGAAGTTTAACCCTCTCAACTCGAGTTGAGAGGGTTAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-1211s1c1
Sequence:CCGGCCTCGCTACAACCTCATTGTTCTCGAGAACAATGAGGTTGTAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-466s1c1
Sequence:CCGGTCTGGATTCTTACCGGATATTCTCGAGAATATCCGGTAAGAATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000107.1-767s1c1
Sequence:CCGGGACACCATCAACATCTGGTTTCTCGAGAAACCAGATGTTGATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028119
VALIDATED
DDB2 MISSION shRNA Bacterial Glycerol Stock
damage-specific DNA binding protein 2, 48kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028119.4-1258s21c1
Sequence:CCGGCCCTATGAACTAAGGACAATACTCGAGTATTGTCCTTAGTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-1227s21c1
Sequence:CCGGATACCCAGATCCTAATCTTAACTCGAGTTAAGATTAGGATCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028119.4-454s21c1
Sequence:CCGGCTAGCTTCTTACCAGGTATTCCTCGAGGAATACCTGGTAAGAAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-725s21c1
Sequence:CCGGGCAACATTCTCAGAGTTTATACTCGAGTATAAACTCTGAGAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-1384s21c1
Sequence:CCGGGCCTCTACTATGGGTTATCATCTCGAGATGATAACCCATAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-981s1c1
Sequence:CCGGCCTGCGCCAAATTAAAGGGAACTCGAGTTCCCTTTAATTTGGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1077s1c1
Sequence:CCGGCCTGACTACTGACCAGAACAACTCGAGTTGTTCTGGTCAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1344s1c1
Sequence:CCGGCGGTATTACTTCGCTCAATGACTCGAGTCATTGAGCGAAGTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1390s1c1
Sequence:CCGGGCCTCTACTATGGGTTATCATCTCGAGATGATAACCCATAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-651s1c1
Sequence:CCGGGCTGAAGTTTAACCATCTCAACTCGAGTTGAGATGGTTAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028119
VALIDATED
DDB2 MISSION shRNA shRNA Plasmid DNA
damage-specific DNA binding protein 2, 48kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028119.4-1258s21c1
Sequence:CCGGCCCTATGAACTAAGGACAATACTCGAGTATTGTCCTTAGTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-1227s21c1
Sequence:CCGGATACCCAGATCCTAATCTTAACTCGAGTTAAGATTAGGATCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028119.4-454s21c1
Sequence:CCGGCTAGCTTCTTACCAGGTATTCCTCGAGGAATACCTGGTAAGAAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-725s21c1
Sequence:CCGGGCAACATTCTCAGAGTTTATACTCGAGTATAAACTCTGAGAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-1384s21c1
Sequence:CCGGGCCTCTACTATGGGTTATCATCTCGAGATGATAACCCATAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-981s1c1
Sequence:CCGGCCTGCGCCAAATTAAAGGGAACTCGAGTTCCCTTTAATTTGGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1077s1c1
Sequence:CCGGCCTGACTACTGACCAGAACAACTCGAGTTGTTCTGGTCAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1344s1c1
Sequence:CCGGCGGTATTACTTCGCTCAATGACTCGAGTCATTGAGCGAAGTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1390s1c1
Sequence:CCGGGCCTCTACTATGGGTTATCATCTCGAGATGATAACCCATAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-651s1c1
Sequence:CCGGGCTGAAGTTTAACCATCTCAACTCGAGTTGAGATGGTTAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028119
VALIDATED
DDB2 MISSION shRNA Lentiviral Transduction Particles
damage-specific DNA binding protein 2, 48kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028119.4-1258s21c1
Sequence:CCGGCCCTATGAACTAAGGACAATACTCGAGTATTGTCCTTAGTTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-1227s21c1
Sequence:CCGGATACCCAGATCCTAATCTTAACTCGAGTTAAGATTAGGATCTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028119.4-454s21c1
Sequence:CCGGCTAGCTTCTTACCAGGTATTCCTCGAGGAATACCTGGTAAGAAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-725s21c1
Sequence:CCGGGCAACATTCTCAGAGTTTATACTCGAGTATAAACTCTGAGAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028119.4-1384s21c1
Sequence:CCGGGCCTCTACTATGGGTTATCATCTCGAGATGATAACCCATAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-981s1c1
Sequence:CCGGCCTGCGCCAAATTAAAGGGAACTCGAGTTCCCTTTAATTTGGCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1077s1c1
Sequence:CCGGCCTGACTACTGACCAGAACAACTCGAGTTGTTCTGGTCAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1344s1c1
Sequence:CCGGCGGTATTACTTCGCTCAATGACTCGAGTCATTGAGCGAAGTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-1390s1c1
Sequence:CCGGGCCTCTACTATGGGTTATCATCTCGAGATGATAACCCATAGTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028119.2-651s1c1
Sequence:CCGGGCTGAAGTTTAACCATCTCAACTCGAGTTGAGATGGTTAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks