EMAIL THIS PAGE TO A FRIEND

DDC

dopa decarboxylase (aromatic L-amino acid decarboxylase)

73 Gene Product Result for
Synonyms: AADC
Gene ID:
Human(1644) Summary: The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
Mouse(13195) dopa decarboxylase
Rat(24311) dopa decarboxylase (aromatic L-amino acid decarboxylase)
domestic guinea pig(100135516) dopa decarboxylase
naked mole-rat(101697555) dopa decarboxylase (aromatic L-amino acid decarboxylase)
sheep(101106765) dopa decarboxylase (aromatic L-amino acid decarboxylase)
Zebrafish(406651) dopa decarboxylase
chicken(420947) dopa decarboxylase (aromatic L-amino acid decarboxylase)
fruit fly(35190) Dopa decarboxylase
dog(606852) dopa decarboxylase (aromatic L-amino acid decarboxylase)
cow(280762) dopa decarboxylase (aromatic L-amino acid decarboxylase)
Horse(100052557) dopa decarboxylase (aromatic L-amino acid decarboxylase)
domestic cat(101082989) dopa decarboxylase (aromatic L-amino acid decarboxylase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108547 Anti-DDC IgG fraction of antiserum dog, rat, rabbit, bovine, guinea pig, horse, mouse, zebrafish, human
immunohistochemistry, western blot pricing
GW22156A Anti-DDC (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
GW22156B Anti-DDC (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1405703 Anti-DDC antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA017742 Anti-DDC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV41425 Anti-DDC antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, canine, rat, zebrafish, rabbit, human, mouse, pig, horse
immunohistochemistry, western blot pricing
SAB2104803 Anti-DDC antibody produced in rabbit affinity isolated antibody human, rat, rabbit, mouse, horse, guinea pig
western blot pricing
SAB2500325 Anti-DOPA Decarboxylase antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
AMAB91089 Monoclonal Anti-DDC antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2962, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
D0180 Monoclonal Anti-DOPA Decarboxylase (DDC) antibody produced in mouse clone DDC-109, ascites fluid canine, rat, human, monkey, bovine, guinea pig, sheep, rabbit
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000790 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062541 MISSION® esiRNA esiRNA targeting mouse Ddc (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000790 Rosetta Predictions human pricing
NM_001082971 Rosetta Predictions human pricing
NM_012545 Rosetta Predictions rat pricing
NM_016672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017114 predicted 1204
2 SASI_Hs01_00017115 predicted 1321
3 SASI_Hs01_00017116 predicted 960
4 SASI_Hs01_00017117 predicted 825
5 SASI_Hs01_00017118 predicted 930
6 SASI_Hs01_00017119 predicted 1133
7 SASI_Hs01_00017120 predicted 1194
8 SASI_Hs01_00017121 predicted 463
9 SASI_Hs01_00017122 predicted 1116
10 SASI_Hs01_00017123 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316812 predicted 1321
2 SASI_Hs02_00316813 predicted 1430
3 SASI_Hs02_00316814 predicted 1076
4 SASI_Hs02_00316815 predicted 949
5 SASI_Hs02_00316816 predicted 1036
6 SASI_Hs02_00316817 predicted 1240
7 SASI_Hs02_00316818 predicted 1311
8 SASI_Hs02_00316819 predicted 570
9 SASI_Hs02_00316820 predicted 1230
10 SASI_Hs02_00316821 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038589 predicted 654
2 SASI_Rn01_00038590 predicted 956
3 SASI_Rn01_00038592 predicted 1101
4 SASI_Rn01_00038593 predicted 671
5 SASI_Rn02_00259624 predicted 1050
6 SASI_Rn02_00259625 predicted 1133
7 SASI_Rn01_00038595 predicted 1326
8 SASI_Rn01_00038596 predicted 1268
9 SASI_Rn02_00259626 predicted 226
10 SASI_Rn02_00259627 predicted 950
11 SASI_Rn01_00038591 predicted 599
12 SASI_Rn01_00038594 predicted 910
13 SASI_Rn01_00038597 predicted 1023
14 SASI_Rn01_00038598 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035536 predicted 947
2 SASI_Mm01_00035537 predicted 356
3 SASI_Mm01_00035538 predicted 356
4 SASI_Mm01_00035539 predicted 325
5 SASI_Mm01_00035540 predicted 1272
6 SASI_Mm02_00323304 predicted 667
7 SASI_Mm01_00035542 predicted 1326
8 SASI_Mm01_00035543 predicted 944
9 SASI_Mm01_00035544 predicted 1094
10 SASI_Mm01_00035545 predicted 1084
11 SASI_Mm01_00035541 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016672
VALIDATED
DDC MISSION shRNA Bacterial Glycerol Stock
dopa decarboxylase (aromatic L-amino acid decarboxylase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-985s1c1
Sequence:CCGGGCCTTTAATATGGACCCTGTTCTCGAGAACAGGGTCCATATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-986s1c1
Sequence:CCGGCCTTTAATATGGACCCTGTTTCTCGAGAAACAGGGTCCATATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-1256s1c1
Sequence:CCGGGCTCCAATGAGTTGAACGAAACTCGAGTTTCGTTCAACTCATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-160s1c1
Sequence:CCGGCCAGAAACATACGAGGACATACTCGAGTATGTCCTCGTATGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016672.1-605s1c1
Sequence:CCGGCTGGGTTAATTGGTGGAATAACTCGAGTTATTCCACCAATTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-538s21c1
Sequence:CCGGCTACTGGCTGCTCGGACTAAACTCGAGTTTAGTCCGAGCAGCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016672.3-1586s21c1
Sequence:CCGGACCACTCCGTCTTCGTGAAATCTCGAGATTTCACGAAGACGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-101s21c1
Sequence:CCGGGCAAGGAGATGGTGGATTATACTCGAGTATAATCCACCATCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-1316s21c1
Sequence:CCGGGCTCCAATGAGTTGAACGAAACTCGAGTTTCGTTCAACTCATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-1046s21c1
Sequence:CCGGCCTTTAATATGGACCCTGTTTCTCGAGAAACAGGGTCCATATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016672
VALIDATED
DDC MISSION shRNA shRNA Plasmid DNA
dopa decarboxylase (aromatic L-amino acid decarboxylase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-985s1c1
Sequence:CCGGGCCTTTAATATGGACCCTGTTCTCGAGAACAGGGTCCATATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-986s1c1
Sequence:CCGGCCTTTAATATGGACCCTGTTTCTCGAGAAACAGGGTCCATATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-1256s1c1
Sequence:CCGGGCTCCAATGAGTTGAACGAAACTCGAGTTTCGTTCAACTCATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-160s1c1
Sequence:CCGGCCAGAAACATACGAGGACATACTCGAGTATGTCCTCGTATGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016672.1-605s1c1
Sequence:CCGGCTGGGTTAATTGGTGGAATAACTCGAGTTATTCCACCAATTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-538s21c1
Sequence:CCGGCTACTGGCTGCTCGGACTAAACTCGAGTTTAGTCCGAGCAGCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016672.3-1586s21c1
Sequence:CCGGACCACTCCGTCTTCGTGAAATCTCGAGATTTCACGAAGACGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-101s21c1
Sequence:CCGGGCAAGGAGATGGTGGATTATACTCGAGTATAATCCACCATCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-1316s21c1
Sequence:CCGGGCTCCAATGAGTTGAACGAAACTCGAGTTTCGTTCAACTCATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-1046s21c1
Sequence:CCGGCCTTTAATATGGACCCTGTTTCTCGAGAAACAGGGTCCATATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016672
VALIDATED
DDC MISSION shRNA Lentiviral Transduction Particles
dopa decarboxylase (aromatic L-amino acid decarboxylase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-985s1c1
Sequence:CCGGGCCTTTAATATGGACCCTGTTCTCGAGAACAGGGTCCATATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-986s1c1
Sequence:CCGGCCTTTAATATGGACCCTGTTTCTCGAGAAACAGGGTCCATATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-1256s1c1
Sequence:CCGGGCTCCAATGAGTTGAACGAAACTCGAGTTTCGTTCAACTCATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016672.1-160s1c1
Sequence:CCGGCCAGAAACATACGAGGACATACTCGAGTATGTCCTCGTATGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016672.1-605s1c1
Sequence:CCGGCTGGGTTAATTGGTGGAATAACTCGAGTTATTCCACCAATTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-538s21c1
Sequence:CCGGCTACTGGCTGCTCGGACTAAACTCGAGTTTAGTCCGAGCAGCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016672.3-1586s21c1
Sequence:CCGGACCACTCCGTCTTCGTGAAATCTCGAGATTTCACGAAGACGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-101s21c1
Sequence:CCGGGCAAGGAGATGGTGGATTATACTCGAGTATAATCCACCATCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-1316s21c1
Sequence:CCGGGCTCCAATGAGTTGAACGAAACTCGAGTTTCGTTCAACTCATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016672.3-1046s21c1
Sequence:CCGGCCTTTAATATGGACCCTGTTTCTCGAGAAACAGGGTCCATATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000790
VALIDATED
DDC MISSION shRNA Bacterial Glycerol Stock
dopa decarboxylase (aromatic L-amino acid decarboxylase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000790.1-1669s1c1
Sequence:CCGGGCTTAGTATCTCATCAACAAACTCGAGTTTGTTGATGAGATACTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-243s1c1
Sequence:CCGGCGACGTTGAGAAGATAATCATCTCGAGATGATTATCTTCTCAACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000790.1-763s1c1
Sequence:CCGGGCTGGCCTGATTCCTTTCTTTCTCGAGAAAGAAAGGAATCAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-1341s1c1
Sequence:CCGGGCAAAGAATAAACAGTGCCAACTCGAGTTGGCACTGTTTATTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-121s1c1
Sequence:CCGGGCCAACTACATGGAAGGCATTCTCGAGAATGCCTTCCATGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000790.3-1686s21c1
Sequence:CCGGGCTTAGTATCTCATCAACAAACTCGAGTTTGTTGATGAGATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-964s21c1
Sequence:CCGGTTGCAGATTCATTCAACTTTACTCGAGTAAAGTTGAATGAATCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-1307s21c1
Sequence:CCGGGCTTGTCTGCTTTCGGCTAAACTCGAGTTTAGCCGAAAGCAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-670s21c1
Sequence:CCGGTGGAAAGAGCTGGGTTAATTGCTCGAGCAATTAACCCAGCTCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-260s21c1
Sequence:CCGGCGACGTTGAGAAGATAATCATCTCGAGATGATTATCTTCTCAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000790
VALIDATED
DDC MISSION shRNA shRNA Plasmid DNA
dopa decarboxylase (aromatic L-amino acid decarboxylase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000790.1-1669s1c1
Sequence:CCGGGCTTAGTATCTCATCAACAAACTCGAGTTTGTTGATGAGATACTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-243s1c1
Sequence:CCGGCGACGTTGAGAAGATAATCATCTCGAGATGATTATCTTCTCAACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000790.1-763s1c1
Sequence:CCGGGCTGGCCTGATTCCTTTCTTTCTCGAGAAAGAAAGGAATCAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-1341s1c1
Sequence:CCGGGCAAAGAATAAACAGTGCCAACTCGAGTTGGCACTGTTTATTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-121s1c1
Sequence:CCGGGCCAACTACATGGAAGGCATTCTCGAGAATGCCTTCCATGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000790.3-1686s21c1
Sequence:CCGGGCTTAGTATCTCATCAACAAACTCGAGTTTGTTGATGAGATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-964s21c1
Sequence:CCGGTTGCAGATTCATTCAACTTTACTCGAGTAAAGTTGAATGAATCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-1307s21c1
Sequence:CCGGGCTTGTCTGCTTTCGGCTAAACTCGAGTTTAGCCGAAAGCAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-670s21c1
Sequence:CCGGTGGAAAGAGCTGGGTTAATTGCTCGAGCAATTAACCCAGCTCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-260s21c1
Sequence:CCGGCGACGTTGAGAAGATAATCATCTCGAGATGATTATCTTCTCAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000790
VALIDATED
DDC MISSION shRNA Lentiviral Transduction Particles
dopa decarboxylase (aromatic L-amino acid decarboxylase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000790.1-1669s1c1
Sequence:CCGGGCTTAGTATCTCATCAACAAACTCGAGTTTGTTGATGAGATACTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-243s1c1
Sequence:CCGGCGACGTTGAGAAGATAATCATCTCGAGATGATTATCTTCTCAACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000790.1-763s1c1
Sequence:CCGGGCTGGCCTGATTCCTTTCTTTCTCGAGAAAGAAAGGAATCAGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-1341s1c1
Sequence:CCGGGCAAAGAATAAACAGTGCCAACTCGAGTTGGCACTGTTTATTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000790.1-121s1c1
Sequence:CCGGGCCAACTACATGGAAGGCATTCTCGAGAATGCCTTCCATGTAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000790.3-1686s21c1
Sequence:CCGGGCTTAGTATCTCATCAACAAACTCGAGTTTGTTGATGAGATACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-964s21c1
Sequence:CCGGTTGCAGATTCATTCAACTTTACTCGAGTAAAGTTGAATGAATCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-1307s21c1
Sequence:CCGGGCTTGTCTGCTTTCGGCTAAACTCGAGTTTAGCCGAAAGCAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-670s21c1
Sequence:CCGGTGGAAAGAGCTGGGTTAATTGCTCGAGCAATTAACCCAGCTCTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000790.3-260s21c1
Sequence:CCGGCGACGTTGAGAAGATAATCATCTCGAGATGATTATCTTCTCAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks