EMAIL THIS PAGE TO A FRIEND

DDHD1

DDHD domain containing 1

124 Gene Product Result for
Synonyms: PA-PLA1 PAPLA1 SPG28
UniProtKB ID: Q8NEL9, G5E9D1, Q8WVH3, Q96LL2, Q9C0F8
Gene ID:
Mouse(114874) DDHD domain containing 1
Rat(305816) DDHD domain containing 1
chicken(423592) DDHD domain containing 1
cow(338047) DDHD domain containing 1
Horse(100055200) DDHD domain containing 1
domestic cat(101091376) DDHD domain containing 1
dog(480326) DDHD domain containing 1
domestic guinea pig(100731571) DDHD domain containing 1
naked mole-rat(101712889) DDHD domain containing 1
sheep(101112738) DDHD domain containing 1
Domestic Rabbit(100354460) DDHD domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030637 Rosetta Predictions human pricing
NM_001033066 Rosetta Predictions rat pricing
NM_001039106 Rosetta Predictions mouse pricing
NM_001042719 Rosetta Predictions mouse pricing
NM_176845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091006 predicted 1393
2 SASI_Hs01_00091007 predicted 2378
3 SASI_Hs01_00091008 predicted 1038
4 SASI_Hs01_00091009 predicted 1604
5 SASI_Hs01_00091010 predicted 1601
6 SASI_Hs02_00358212 predicted 2173
7 SASI_Hs01_00091011 predicted 1650
8 SASI_Hs01_00091012 predicted 1826
9 SASI_Hs02_00358213 predicted 1201
10 SASI_Hs01_00091013 predicted 2191
11 SASI_Hs01_00091005 predicted 1651
12 SASI_Hs01_00091014 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073702 predicted 1965
2 SASI_Rn01_00073703 predicted 1842
3 SASI_Rn02_00203625 predicted 2158
4 SASI_Rn01_00073704 predicted 2076
5 SASI_Rn01_00073705 predicted 1383
6 SASI_Rn01_00073706 predicted 1601
7 SASI_Rn01_00073707 predicted 940
8 SASI_Rn01_00073708 predicted 2017
9 SASI_Rn01_00073709 predicted 2045
10 SASI_Rn01_00073710 predicted 1730
11 SASI_Rn01_00073711 predicted 1862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289794 predicted 2026
2 SASI_Mm02_00289795 predicted 1439
3 SASI_Mm02_00289796 predicted 2274
4 SASI_Mm02_00289797 predicted 1878
5 SASI_Mm02_00289798 predicted 2073
6 SASI_Mm02_00289799 predicted 1674
7 SASI_Mm02_00289800 predicted 1796
8 SASI_Mm02_00289801 predicted 2108
9 SASI_Mm02_00289802 predicted 2759
10 SASI_Mm02_00289803 predicted 1562
11 SASI_Mm01_00134800 predicted 871
12 SASI_Mm01_00134801 predicted 970
13 SASI_Mm01_00134802 predicted 948
14 SASI_Mm01_00134803 predicted 996
15 SASI_Mm01_00134804 predicted 974
16 SASI_Mm01_00134805 predicted 946
17 SASI_Mm01_00134806 predicted 917
18 SASI_Mm01_00134807 predicted 880
19 SASI_Mm01_00134808 predicted 735
20 SASI_Mm01_00134809 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291045 predicted 2127
2 SASI_Mm02_00291046 predicted 1540
3 SASI_Mm02_00291047 predicted 2381
4 SASI_Mm02_00291048 predicted 1977
5 SASI_Mm02_00291049 predicted 2180
6 SASI_Mm02_00291050 predicted 1773
7 SASI_Mm02_00291051 predicted 1903
8 SASI_Mm02_00291052 predicted 2211
9 SASI_Mm02_00291053 predicted 2944
10 SASI_Mm02_00291054 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346742 predicted 2024
2 SASI_Mm02_00346743 predicted 1442
3 SASI_Mm02_00346744 predicted 2275
4 SASI_Mm02_00346745 predicted 1872
5 SASI_Mm02_00346746 predicted 2075
6 SASI_Mm02_00346747 predicted 1672
7 SASI_Mm02_00346748 predicted 1798
8 SASI_Mm02_00346749 predicted 2105
9 SASI_Mm02_00346750 predicted 2836
10 SASI_Mm02_00346751 predicted 1564
11 SASI_Mm01_00136672 predicted 865
12 SASI_Mm01_00136673 predicted 976
13 SASI_Mm01_00136674 predicted 935
14 SASI_Mm01_00136675 predicted 1000
15 SASI_Mm01_00136676 predicted 969
16 SASI_Mm01_00136677 predicted 943
17 SASI_Mm01_00136678 predicted 919
18 SASI_Mm01_00136679 predicted 870
19 SASI_Mm01_00136680 predicted 733
20 SASI_Mm01_00136681 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030637
VALIDATED
DDHD1 MISSION shRNA Bacterial Glycerol Stock
DDHD domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1683s21c1
Sequence:CCGGAGCAGTGCAATGGACATAATGCTCGAGCATTATGTCCATTGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2738s21c1
Sequence:CCGGCACGTCGCATACTGCCTATTGCTCGAGCAATAGGCAGTATGCGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1311s21c1
Sequence:CCGGAGTGATGCAACAACATCTAAACTCGAGTTTAGATGTTGTTGCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2180s21c1
Sequence:CCGGTTGTAACCGGTTACTAAATATCTCGAGATATTTAGTAACCGGTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2276s21c1
Sequence:CCGGCCAGATCCACTGGTACAATACCTCGAGGTATTGTACCAGTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030637.2-3015s21c1
Sequence:CCGGAGTTCTGAAGAAGTCATTTACCTCGAGGTAAATGACTTCTTCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1842s21c1
Sequence:CCGGTTGGGATGTGTAATTACTTATCTCGAGATAAGTAATTACACATCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1820s21c1
Sequence:CCGGAGTCTCAATAGTATCACATTCCTCGAGGAATGTGATACTATTGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-2379s1c1
Sequence:CCGGGCCGACACTATGGAGAATCTACTCGAGTAGATTCTCCATAGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-1601s1c1
Sequence:CCGGCCTGACAAAGTACGAGGTTTACTCGAGTAAACCTCGTACTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-1949s1c1
Sequence:CCGGCGGCTGAAGGAAATAGAAGAACTCGAGTTCTTCTATTTCCTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030637
VALIDATED
DDHD1 MISSION shRNA shRNA Plasmid DNA
DDHD domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1683s21c1
Sequence:CCGGAGCAGTGCAATGGACATAATGCTCGAGCATTATGTCCATTGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2738s21c1
Sequence:CCGGCACGTCGCATACTGCCTATTGCTCGAGCAATAGGCAGTATGCGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1311s21c1
Sequence:CCGGAGTGATGCAACAACATCTAAACTCGAGTTTAGATGTTGTTGCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2180s21c1
Sequence:CCGGTTGTAACCGGTTACTAAATATCTCGAGATATTTAGTAACCGGTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2276s21c1
Sequence:CCGGCCAGATCCACTGGTACAATACCTCGAGGTATTGTACCAGTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030637.2-3015s21c1
Sequence:CCGGAGTTCTGAAGAAGTCATTTACCTCGAGGTAAATGACTTCTTCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1842s21c1
Sequence:CCGGTTGGGATGTGTAATTACTTATCTCGAGATAAGTAATTACACATCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1820s21c1
Sequence:CCGGAGTCTCAATAGTATCACATTCCTCGAGGAATGTGATACTATTGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-2379s1c1
Sequence:CCGGGCCGACACTATGGAGAATCTACTCGAGTAGATTCTCCATAGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-1601s1c1
Sequence:CCGGCCTGACAAAGTACGAGGTTTACTCGAGTAAACCTCGTACTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-1949s1c1
Sequence:CCGGCGGCTGAAGGAAATAGAAGAACTCGAGTTCTTCTATTTCCTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030637
VALIDATED
DDHD1 MISSION shRNA Lentiviral Transduction Particles
DDHD domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1683s21c1
Sequence:CCGGAGCAGTGCAATGGACATAATGCTCGAGCATTATGTCCATTGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2738s21c1
Sequence:CCGGCACGTCGCATACTGCCTATTGCTCGAGCAATAGGCAGTATGCGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1311s21c1
Sequence:CCGGAGTGATGCAACAACATCTAAACTCGAGTTTAGATGTTGTTGCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2180s21c1
Sequence:CCGGTTGTAACCGGTTACTAAATATCTCGAGATATTTAGTAACCGGTTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-2276s21c1
Sequence:CCGGCCAGATCCACTGGTACAATACCTCGAGGTATTGTACCAGTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030637.2-3015s21c1
Sequence:CCGGAGTTCTGAAGAAGTCATTTACCTCGAGGTAAATGACTTCTTCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1842s21c1
Sequence:CCGGTTGGGATGTGTAATTACTTATCTCGAGATAAGTAATTACACATCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030637.2-1820s21c1
Sequence:CCGGAGTCTCAATAGTATCACATTCCTCGAGGAATGTGATACTATTGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-2379s1c1
Sequence:CCGGGCCGACACTATGGAGAATCTACTCGAGTAGATTCTCCATAGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-1601s1c1
Sequence:CCGGCCTGACAAAGTACGAGGTTTACTCGAGTAAACCTCGTACTTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030637.1-1949s1c1
Sequence:CCGGCGGCTGAAGGAAATAGAAGAACTCGAGTTCTTCTATTTCCTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176845
VALIDATED
DDHD1 MISSION shRNA Bacterial Glycerol Stock
DDHD domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176845.4-2935s21c1
Sequence:CCGGTTCAGTTCTAAAGGAGTTATTCTCGAGAATAACTCCTTTAGAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-1604s21c1
Sequence:CCGGAGCAAGAGCTGAATCGATTATCTCGAGATAATCGATTCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-2081s21c1
Sequence:CCGGACAGATTAGAACCGTTGATTTCTCGAGAAATCAACGGTTCTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-2029s21c1
Sequence:CCGGGAGATCTGTAACCGCTTACTACTCGAGTAGTAAGCGGTTACAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-1443s21c1
Sequence:CCGGGCCTGTTGAATGGCGATCAAACTCGAGTTTGATCGCCATTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-547s1c1
Sequence:CCGGGCAGACTTCTCATATCGTGTTCTCGAGAACACGATATGAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176845.2-1664s1c1
Sequence:CCGGCCATCTAAAGACTCACTGGAACTCGAGTTCCAGTGAGTCTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-697s1c1
Sequence:CCGGGCCTGTTGAATGGCGATCAAACTCGAGTTTGATCGCCATTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-1283s1c1
Sequence:CCGGGAGATCTGTAACCGCTTACTACTCGAGTAGTAAGCGGTTACAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-2188s1c1
Sequence:CCGGGTTCAGTTCTAAAGGAGTTATCTCGAGATAACTCCTTTAGAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176845
VALIDATED
DDHD1 MISSION shRNA shRNA Plasmid DNA
DDHD domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176845.4-2935s21c1
Sequence:CCGGTTCAGTTCTAAAGGAGTTATTCTCGAGAATAACTCCTTTAGAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-1604s21c1
Sequence:CCGGAGCAAGAGCTGAATCGATTATCTCGAGATAATCGATTCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-2081s21c1
Sequence:CCGGACAGATTAGAACCGTTGATTTCTCGAGAAATCAACGGTTCTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-2029s21c1
Sequence:CCGGGAGATCTGTAACCGCTTACTACTCGAGTAGTAAGCGGTTACAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-1443s21c1
Sequence:CCGGGCCTGTTGAATGGCGATCAAACTCGAGTTTGATCGCCATTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-547s1c1
Sequence:CCGGGCAGACTTCTCATATCGTGTTCTCGAGAACACGATATGAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176845.2-1664s1c1
Sequence:CCGGCCATCTAAAGACTCACTGGAACTCGAGTTCCAGTGAGTCTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-697s1c1
Sequence:CCGGGCCTGTTGAATGGCGATCAAACTCGAGTTTGATCGCCATTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-1283s1c1
Sequence:CCGGGAGATCTGTAACCGCTTACTACTCGAGTAGTAAGCGGTTACAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-2188s1c1
Sequence:CCGGGTTCAGTTCTAAAGGAGTTATCTCGAGATAACTCCTTTAGAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176845
VALIDATED
DDHD1 MISSION shRNA Lentiviral Transduction Particles
DDHD domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176845.4-2935s21c1
Sequence:CCGGTTCAGTTCTAAAGGAGTTATTCTCGAGAATAACTCCTTTAGAACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-1604s21c1
Sequence:CCGGAGCAAGAGCTGAATCGATTATCTCGAGATAATCGATTCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-2081s21c1
Sequence:CCGGACAGATTAGAACCGTTGATTTCTCGAGAAATCAACGGTTCTAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-2029s21c1
Sequence:CCGGGAGATCTGTAACCGCTTACTACTCGAGTAGTAAGCGGTTACAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176845.4-1443s21c1
Sequence:CCGGGCCTGTTGAATGGCGATCAAACTCGAGTTTGATCGCCATTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-547s1c1
Sequence:CCGGGCAGACTTCTCATATCGTGTTCTCGAGAACACGATATGAGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176845.2-1664s1c1
Sequence:CCGGCCATCTAAAGACTCACTGGAACTCGAGTTCCAGTGAGTCTTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-697s1c1
Sequence:CCGGGCCTGTTGAATGGCGATCAAACTCGAGTTTGATCGCCATTCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-1283s1c1
Sequence:CCGGGAGATCTGTAACCGCTTACTACTCGAGTAGTAAGCGGTTACAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_176845.2-2188s1c1
Sequence:CCGGGTTCAGTTCTAAAGGAGTTATCTCGAGATAACTCCTTTAGAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks