EMAIL THIS PAGE TO A FRIEND

DDHD2

DDHD domain containing 2

Synonyms: SAMWD1 SPG54
UniProtKB ID: O94830, B3KWV2, Q9H8X7
Gene ID:
Mouse(72108) DDHD domain containing 2
Rat(680971) DDHD domain containing 2
Zebrafish(100321082) DDHD domain containing 2
domestic cat(101087397) DDHD domain containing 2
Horse(100059244) DDHD domain containing 2
cow(513116) DDHD domain containing 2
dog(475586) DDHD domain containing 2
chicken(426777) DDHD domain containing 2
sheep(101112451) DDHD domain containing 2
Domestic Rabbit(100352964) DDHD domain containing 2
naked mole-rat(101705573) DDHD domain containing 2
domestic guinea pig(100728856) DDHD domain containing 2
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015214 Rosetta Predictions human pricing
XM_001059724 Rosetta Predictions rat pricing
XM_356065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110260 predicted 344
2 SASI_Hs02_00347323 predicted 1806
3 SASI_Hs01_00110261 predicted 1330
4 SASI_Hs02_00347324 predicted 1709
5 SASI_Hs01_00110262 predicted 1308
6 SASI_Hs01_00110263 predicted 855
7 SASI_Hs01_00110264 predicted 1318
8 SASI_Hs01_00110265 predicted 1424
9 SASI_Hs01_00110267 predicted 1433
10 SASI_Hs01_00110268 predicted 2231
11 SASI_Hs01_00110266 predicted 2349
12 SASI_Hs01_00110269 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294123 predicted 2687
2 SASI_Rn02_00294124 predicted 2455
3 SASI_Rn02_00294125 predicted 2641
4 SASI_Rn02_00294126 predicted 2564
5 SASI_Rn02_00294127 predicted 2388
6 SASI_Rn02_00294128 predicted 2532
7 SASI_Rn02_00294129 predicted 2810
8 SASI_Rn02_00294130 predicted 2553
9 SASI_Rn02_00294131 predicted 2722
10 SASI_Rn02_00294132 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283146 predicted 1477
2 SASI_Mm01_00283147 predicted 1824
3 SASI_Mm01_00283148 predicted 2451
4 SASI_Mm01_00283149 predicted 1453
5 SASI_Mm01_00283150 predicted 2266
6 SASI_Mm01_00283151 predicted 1467
7 SASI_Mm01_00283152 predicted 2005
8 SASI_Mm01_00283153 predicted 1610
9 SASI_Mm01_00283154 predicted 2047
10 SASI_Mm01_00283155 predicted 1936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291291
VALIDATED
DDHD2 MISSION shRNA Bacterial Glycerol Stock
DDHD domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-301s1c1
Sequence:CCGGGCAGCTTGTATGAACCAGTTTCTCGAGAAACTGGTTCATACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1170s1c1
Sequence:CCGGGCTTCTGAAATGAACCGAATACTCGAGTATTCGGTTCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-894s1c1
Sequence:CCGGCGAAGCATTGTACAGTGTGTTCTCGAGAACACACTGTACAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1875s1c1
Sequence:CCGGCCAATGCTGATCCCACATCATCTCGAGATGATGTGGGATCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1939s1c1
Sequence:CCGGCCAGGATGAGTATGGACCTTACTCGAGTAAGGTCCATACTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291291
VALIDATED
DDHD2 MISSION shRNA shRNA Plasmid DNA
DDHD domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-301s1c1
Sequence:CCGGGCAGCTTGTATGAACCAGTTTCTCGAGAAACTGGTTCATACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1170s1c1
Sequence:CCGGGCTTCTGAAATGAACCGAATACTCGAGTATTCGGTTCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-894s1c1
Sequence:CCGGCGAAGCATTGTACAGTGTGTTCTCGAGAACACACTGTACAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1875s1c1
Sequence:CCGGCCAATGCTGATCCCACATCATCTCGAGATGATGTGGGATCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1939s1c1
Sequence:CCGGCCAGGATGAGTATGGACCTTACTCGAGTAAGGTCCATACTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291291
VALIDATED
DDHD2 MISSION shRNA Lentiviral Transduction Particles
DDHD domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-301s1c1
Sequence:CCGGGCAGCTTGTATGAACCAGTTTCTCGAGAAACTGGTTCATACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1170s1c1
Sequence:CCGGGCTTCTGAAATGAACCGAATACTCGAGTATTCGGTTCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-894s1c1
Sequence:CCGGCGAAGCATTGTACAGTGTGTTCTCGAGAACACACTGTACAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1875s1c1
Sequence:CCGGCCAATGCTGATCCCACATCATCTCGAGATGATGTGGGATCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:XM_291291.3-1939s1c1
Sequence:CCGGCCAGGATGAGTATGGACCTTACTCGAGTAAGGTCCATACTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028102
VALIDATED
DDHD2 MISSION shRNA Bacterial Glycerol Stock
DDHD domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1150s21c1
Sequence:CCGGATAGTTTAGGTTCGCTTATATCTCGAGATATAAGCGAACCTAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028102.1-1251s21c1
Sequence:CCGGCGAGGCGATGCATCAACATTACTCGAGTAATGTTGATGCATCGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1747s21c1
Sequence:CCGGTGCTGATCCCACACCATAAAGCTCGAGCTTTATGGTGTGGGATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1685s21c1
Sequence:CCGGATTTGACCCTGTGGCATATAGCTCGAGCTATATGCCACAGGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-2527s21c1
Sequence:CCGGCACTACGGGTGGGAGTATAAGCTCGAGCTTATACTCCCACCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028102
VALIDATED
DDHD2 MISSION shRNA shRNA Plasmid DNA
DDHD domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1150s21c1
Sequence:CCGGATAGTTTAGGTTCGCTTATATCTCGAGATATAAGCGAACCTAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028102.1-1251s21c1
Sequence:CCGGCGAGGCGATGCATCAACATTACTCGAGTAATGTTGATGCATCGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1747s21c1
Sequence:CCGGTGCTGATCCCACACCATAAAGCTCGAGCTTTATGGTGTGGGATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1685s21c1
Sequence:CCGGATTTGACCCTGTGGCATATAGCTCGAGCTATATGCCACAGGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-2527s21c1
Sequence:CCGGCACTACGGGTGGGAGTATAAGCTCGAGCTTATACTCCCACCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028102
VALIDATED
DDHD2 MISSION shRNA Lentiviral Transduction Particles
DDHD domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1150s21c1
Sequence:CCGGATAGTTTAGGTTCGCTTATATCTCGAGATATAAGCGAACCTAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028102.1-1251s21c1
Sequence:CCGGCGAGGCGATGCATCAACATTACTCGAGTAATGTTGATGCATCGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1747s21c1
Sequence:CCGGTGCTGATCCCACACCATAAAGCTCGAGCTTTATGGTGTGGGATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-1685s21c1
Sequence:CCGGATTTGACCCTGTGGCATATAGCTCGAGCTATATGCCACAGGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028102.1-2527s21c1
Sequence:CCGGCACTACGGGTGGGAGTATAAGCTCGAGCTTATACTCCCACCCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015214
VALIDATED
DDHD2 MISSION shRNA Bacterial Glycerol Stock
DDHD domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-380s21c1
Sequence:CCGGGCAGCTTGTATGAACCAGTTTCTCGAGAAACTGGTTCATACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-973s21c1
Sequence:CCGGCGAAGCATTGTACAGTGTGTTCTCGAGAACACACTGTACAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-2018s21c1
Sequence:CCGGCCAGGATGAGTATGGACCTTACTCGAGTAAGGTCCATACTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015214.1-1249s21c1
Sequence:CCGGGCTTCTGAAATGAACCGAATACTCGAGTATTCGGTTCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-1954s21c1
Sequence:CCGGCCAATGCTGATCCCACATCATCTCGAGATGATGTGGGATCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015214
VALIDATED
DDHD2 MISSION shRNA shRNA Plasmid DNA
DDHD domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-380s21c1
Sequence:CCGGGCAGCTTGTATGAACCAGTTTCTCGAGAAACTGGTTCATACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-973s21c1
Sequence:CCGGCGAAGCATTGTACAGTGTGTTCTCGAGAACACACTGTACAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-2018s21c1
Sequence:CCGGCCAGGATGAGTATGGACCTTACTCGAGTAAGGTCCATACTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015214.1-1249s21c1
Sequence:CCGGGCTTCTGAAATGAACCGAATACTCGAGTATTCGGTTCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-1954s21c1
Sequence:CCGGCCAATGCTGATCCCACATCATCTCGAGATGATGTGGGATCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015214
VALIDATED
DDHD2 MISSION shRNA Lentiviral Transduction Particles
DDHD domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-380s21c1
Sequence:CCGGGCAGCTTGTATGAACCAGTTTCTCGAGAAACTGGTTCATACAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-973s21c1
Sequence:CCGGCGAAGCATTGTACAGTGTGTTCTCGAGAACACACTGTACAATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-2018s21c1
Sequence:CCGGCCAGGATGAGTATGGACCTTACTCGAGTAAGGTCCATACTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015214.1-1249s21c1
Sequence:CCGGGCTTCTGAAATGAACCGAATACTCGAGTATTCGGTTCATTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015214.1-1954s21c1
Sequence:CCGGCCAATGCTGATCCCACATCATCTCGAGATGATGTGGGATCAGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks