EMAIL THIS PAGE TO A FRIEND

DDI1

DNA-damage inducible 1 homolog 1 (S. cerevisiae)

106 Gene Product Result for
UniProtKB ID: Q8WTU0, Q7Z4U6, Q8WTS3
Gene ID:
Mouse(71829) DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)
Rat(367012) DNA-damage inducible 1 homolog 1 (S. cerevisiae)
domestic guinea pig(100715611) DNA-damage inducible 1 homolog 1 (S. cerevisiae)
naked mole-rat(101696412) DNA-damage inducible 1 homolog 1 (S. cerevisiae)
sheep(101117530) DNA-damage inducible 1 homolog 1 (S. cerevisiae)
domestic cat(101085234) DNA-damage inducible 1 homolog 1 (S. cerevisiae)
cow(539082) DNA-damage inducible 1 homolog 1 (S. cerevisiae)
dog(611726) DNA-damage inducible 1 homolog 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001711 Rosetta Predictions human pricing
NM_001085475 Rosetta Predictions rat pricing
NM_027942 Rosetta Predictions mouse pricing
XM_885770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215237 predicted 1493
2 SASI_Hs01_00215240 predicted 1342
3 SASI_Hs01_00215241 predicted 1420
4 SASI_Hs01_00215242 predicted 1218
5 SASI_Hs01_00215243 predicted 1128
6 SASI_Hs01_00215244 predicted 1384
7 SASI_Hs01_00215245 predicted 958
8 SASI_Hs01_00215246 predicted 1232
9 SASI_Hs02_00303899 predicted 1490
10 SASI_Hs02_00303900 predicted 1064
11 SASI_Hs01_00215238 predicted 1151
12 SASI_Hs01_00215239 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209051 predicted 430
2 SASI_Rn02_00209052 predicted 415
3 SASI_Rn02_00209053 predicted 789
4 SASI_Rn02_00209054 predicted 1435
5 SASI_Rn02_00209055 predicted 748
6 SASI_Rn02_00209056 predicted 279
7 SASI_Rn02_00209057 predicted 1055
8 SASI_Rn02_00209058 predicted 317
9 SASI_Rn02_00209059 predicted 951
10 SASI_Rn02_00209060 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332943 predicted 1208
2 SASI_Mm02_00332944 predicted 439
3 SASI_Mm02_00332945 predicted 1013
4 SASI_Mm02_00332946 predicted 243
5 SASI_Mm02_00332947 predicted 943
6 SASI_Mm02_00332948 predicted 806
7 SASI_Mm02_00332949 predicted 907
8 SASI_Mm02_00332950 predicted 540
9 SASI_Mm02_00332951 predicted 706
10 SASI_Mm02_00332952 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237918 predicted 3864
2 SASI_Mm01_00237919 predicted 3990
3 SASI_Mm01_00237920 predicted 3743
4 SASI_Mm01_00237921 predicted 3544
5 SASI_Mm01_00237922 predicted 3579
6 SASI_Mm01_00237923 predicted 3585
7 SASI_Mm01_00237924 predicted 4017
8 SASI_Mm01_00237925 predicted 3896
9 SASI_Mm01_00237926 predicted 3623
10 SASI_Mm01_00237927 predicted 3669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001711
DDI1 MISSION shRNA Bacterial Glycerol Stock
DNA-damage inducible 1 homolog 1 (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001711.2-1832s21c1
Sequence:CCGGATTTCACATCAGCACTAATAACTCGAGTTATTAGTGCTGATGTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001711.2-1740s21c1
Sequence:CCGGTTACAGGTGGCTTATCCAAATCTCGAGATTTGGATAAGCCACCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1193s1c1
Sequence:CCGGCAACCCATGGATATGCTTCTACTCGAGTAGAAGCATATCCATGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001711.1-2046s1c1
Sequence:CCGGGCCACATTTGAGAAAGTGGATCTCGAGATCCACTTTCTCAAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1109s1c1
Sequence:CCGGCAGAGAATTATTGGCCGTGTTCTCGAGAACACGGCCAATAATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1228s1c1
Sequence:CCGGCCGGAGACATCAATGTTCCATCTCGAGATGGAACATTGATGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1348s1c1
Sequence:CCGGGCAAGATGAGTCTTCGGACAACTCGAGTTGTCCGAAGACTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001711
DDI1 MISSION shRNA shRNA Plasmid DNA
DNA-damage inducible 1 homolog 1 (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001711.2-1832s21c1
Sequence:CCGGATTTCACATCAGCACTAATAACTCGAGTTATTAGTGCTGATGTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001711.2-1740s21c1
Sequence:CCGGTTACAGGTGGCTTATCCAAATCTCGAGATTTGGATAAGCCACCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1193s1c1
Sequence:CCGGCAACCCATGGATATGCTTCTACTCGAGTAGAAGCATATCCATGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001711.1-2046s1c1
Sequence:CCGGGCCACATTTGAGAAAGTGGATCTCGAGATCCACTTTCTCAAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1109s1c1
Sequence:CCGGCAGAGAATTATTGGCCGTGTTCTCGAGAACACGGCCAATAATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1228s1c1
Sequence:CCGGCCGGAGACATCAATGTTCCATCTCGAGATGGAACATTGATGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1348s1c1
Sequence:CCGGGCAAGATGAGTCTTCGGACAACTCGAGTTGTCCGAAGACTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001711
DDI1 MISSION shRNA Lentiviral Transduction Particles
DNA-damage inducible 1 homolog 1 (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001711.2-1832s21c1
Sequence:CCGGATTTCACATCAGCACTAATAACTCGAGTTATTAGTGCTGATGTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001711.2-1740s21c1
Sequence:CCGGTTACAGGTGGCTTATCCAAATCTCGAGATTTGGATAAGCCACCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1193s1c1
Sequence:CCGGCAACCCATGGATATGCTTCTACTCGAGTAGAAGCATATCCATGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001711.1-2046s1c1
Sequence:CCGGGCCACATTTGAGAAAGTGGATCTCGAGATCCACTTTCTCAAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1109s1c1
Sequence:CCGGCAGAGAATTATTGGCCGTGTTCTCGAGAACACGGCCAATAATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1228s1c1
Sequence:CCGGCCGGAGACATCAATGTTCCATCTCGAGATGGAACATTGATGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001711.1-1348s1c1
Sequence:CCGGGCAAGATGAGTCTTCGGACAACTCGAGTTGTCCGAAGACTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027942
DDI1 MISSION shRNA Bacterial Glycerol Stock
DNA-damage inducible 1 homolog 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-535s21c1
Sequence:GTACCGGTATCACCATCATCAACGTATACTCGAGTATACGTTGATGATGGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-916s21c1
Sequence:CCGGCAAGTCGCTATGCTCTATATTCTCGAGAATATAGAGCATAGCGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-790s21c1
Sequence:CCGGTTTCGTCTTTACTCTACTAACCTCGAGGTTAGTAGAGTAAAGACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-1179s21c1
Sequence:CCGGTATCCTTCTAGGGCTTGATATCTCGAGATATCAAGCCCTAGAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-1011s21c1
Sequence:CCGGTTGTGCTGAGAGATGTAATATCTCGAGATATTACATCTCTCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027942
DDI1 MISSION shRNA shRNA Plasmid DNA
DNA-damage inducible 1 homolog 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-535s21c1
Sequence:GTACCGGTATCACCATCATCAACGTATACTCGAGTATACGTTGATGATGGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-916s21c1
Sequence:CCGGCAAGTCGCTATGCTCTATATTCTCGAGAATATAGAGCATAGCGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-790s21c1
Sequence:CCGGTTTCGTCTTTACTCTACTAACCTCGAGGTTAGTAGAGTAAAGACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-1179s21c1
Sequence:CCGGTATCCTTCTAGGGCTTGATATCTCGAGATATCAAGCCCTAGAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-1011s21c1
Sequence:CCGGTTGTGCTGAGAGATGTAATATCTCGAGATATTACATCTCTCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027942
DDI1 MISSION shRNA Lentiviral Transduction Particles
DNA-damage inducible 1 homolog 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-535s21c1
Sequence:GTACCGGTATCACCATCATCAACGTATACTCGAGTATACGTTGATGATGGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-916s21c1
Sequence:CCGGCAAGTCGCTATGCTCTATATTCTCGAGAATATAGAGCATAGCGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-790s21c1
Sequence:CCGGTTTCGTCTTTACTCTACTAACCTCGAGGTTAGTAGAGTAAAGACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-1179s21c1
Sequence:CCGGTATCCTTCTAGGGCTTGATATCTCGAGATATCAAGCCCTAGAAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027942.1-1011s21c1
Sequence:CCGGTTGTGCTGAGAGATGTAATATCTCGAGATATTACATCTCTCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks