EMAIL THIS PAGE TO A FRIEND

DDI2

DNA-damage inducible 1 homolog 2 (S. cerevisiae)

62 Gene Product Result for
Synonyms: RP4-680D5.5
UniProtKB ID: Q5TDH0, A8KAE1, Q7RTZ0, Q9BRT1
Gene ID:
Mouse(68817) DNA-damage inducible protein 2
Rat(313668) DNA-damage inducible protein 2
Zebrafish(386644) DNA-damage inducible protein 2
cow(515551) DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Horse(100054192) DNA-damage inducible 1 homolog 2 (S. cerevisiae)
domestic cat(101083950) DNA-damage inducible 1 homolog 2 (S. cerevisiae)
dog(487429) DNA-damage inducible 1 homolog 2 (S. cerevisiae)
chicken(425541) DNA-damage inducible 1 homolog 2 (S. cerevisiae)
sheep(101110160) DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302289 ANTI-DDI2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032341 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032341 Rosetta Predictions human pricing
NM_001034149 Rosetta Predictions rat pricing
NM_001017966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215367 predicted 1356
2 SASI_Hs02_00359727 predicted 1088
3 SASI_Hs01_00215368 predicted 373
4 SASI_Hs01_00215369 predicted 313
5 SASI_Hs01_00215370 predicted 1084
6 SASI_Hs01_00215371 predicted 969
7 SASI_Hs02_00359728 predicted 1223
8 SASI_Hs01_00215373 predicted 1221
9 SASI_Hs01_00215374 predicted 886
10 SASI_Hs02_00359729 predicted 1203
11 SASI_Hs01_00215372 predicted 791
12 SASI_Hs01_00215375 predicted 788
13 SASI_Hs01_00215376 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040805 predicted 911
2 SASI_Rn01_00040806 predicted 446
3 SASI_Rn01_00040807 predicted 819
4 SASI_Rn01_00040808 predicted 974
5 SASI_Rn01_00040809 predicted 1050
6 SASI_Rn01_00040810 predicted 1351
7 SASI_Rn02_00204005 predicted 1155
8 SASI_Rn02_00204006 predicted 973
9 SASI_Rn01_00040812 predicted 721
10 SASI_Rn01_00040813 predicted 970
11 SASI_Rn01_00040811 predicted 1303
12 SASI_Rn01_00040814 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082538 predicted 500
2 SASI_Mm01_00082539 predicted 360
3 SASI_Mm01_00082540 predicted 1209
4 SASI_Mm01_00082541 predicted 1470
5 SASI_Mm01_00082542 predicted 1499
6 SASI_Mm01_00082543 predicted 937
7 SASI_Mm01_00082544 predicted 1022
8 SASI_Mm01_00082545 predicted 826
9 SASI_Mm01_00082546 predicted 1410
10 SASI_Mm01_00082547 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017966
VALIDATED
DDI2 MISSION shRNA Bacterial Glycerol Stock
DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1341s1c1
Sequence:CCGGGCAGACCAAGAATTAGCAGAACTCGAGTTCTGCTAATTCTTGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1063s1c1
Sequence:CCGGGCACACAGAAGATTATTGGAACTCGAGTTCCAATAATCTTCTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1193s1c1
Sequence:CCGGGCACCAGTGTTCTATTGACTTCTCGAGAAGTCAATAGAACACTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-810s1c1
Sequence:CCGGGCTCAGGCAAAGATAGAAGAACTCGAGTTCTTCTATCTTTGCCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1332s1c1
Sequence:CCGGGAGGAAATTGCAGACCAAGAACTCGAGTTCTTGGTCTGCAATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1082s21c1
Sequence:CCGGGCACACAGAAGATTATTGGAACTCGAGTTCCAATAATCTTCTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1360s21c1
Sequence:CCGGGCAGACCAAGAATTAGCAGAACTCGAGTTCTGCTAATTCTTGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017966.2-984s21c1
Sequence:CCGGAGGAGCCCAGATGACTATTATCTCGAGATAATAGTCATCTGGGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1351s21c1
Sequence:CCGGGAGGAAATTGCAGACCAAGAACTCGAGTTCTTGGTCTGCAATTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-405s21c1
Sequence:CCGGACTGGCTTCTTACGGTTTAAACTCGAGTTTAAACCGTAAGAAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017966
VALIDATED
DDI2 MISSION shRNA shRNA Plasmid DNA
DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1341s1c1
Sequence:CCGGGCAGACCAAGAATTAGCAGAACTCGAGTTCTGCTAATTCTTGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1063s1c1
Sequence:CCGGGCACACAGAAGATTATTGGAACTCGAGTTCCAATAATCTTCTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1193s1c1
Sequence:CCGGGCACCAGTGTTCTATTGACTTCTCGAGAAGTCAATAGAACACTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-810s1c1
Sequence:CCGGGCTCAGGCAAAGATAGAAGAACTCGAGTTCTTCTATCTTTGCCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1332s1c1
Sequence:CCGGGAGGAAATTGCAGACCAAGAACTCGAGTTCTTGGTCTGCAATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1082s21c1
Sequence:CCGGGCACACAGAAGATTATTGGAACTCGAGTTCCAATAATCTTCTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1360s21c1
Sequence:CCGGGCAGACCAAGAATTAGCAGAACTCGAGTTCTGCTAATTCTTGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017966.2-984s21c1
Sequence:CCGGAGGAGCCCAGATGACTATTATCTCGAGATAATAGTCATCTGGGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1351s21c1
Sequence:CCGGGAGGAAATTGCAGACCAAGAACTCGAGTTCTTGGTCTGCAATTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-405s21c1
Sequence:CCGGACTGGCTTCTTACGGTTTAAACTCGAGTTTAAACCGTAAGAAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017966
VALIDATED
DDI2 MISSION shRNA Lentiviral Transduction Particles
DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1341s1c1
Sequence:CCGGGCAGACCAAGAATTAGCAGAACTCGAGTTCTGCTAATTCTTGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1063s1c1
Sequence:CCGGGCACACAGAAGATTATTGGAACTCGAGTTCCAATAATCTTCTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1193s1c1
Sequence:CCGGGCACCAGTGTTCTATTGACTTCTCGAGAAGTCAATAGAACACTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-810s1c1
Sequence:CCGGGCTCAGGCAAAGATAGAAGAACTCGAGTTCTTCTATCTTTGCCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017966.1-1332s1c1
Sequence:CCGGGAGGAAATTGCAGACCAAGAACTCGAGTTCTTGGTCTGCAATTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1082s21c1
Sequence:CCGGGCACACAGAAGATTATTGGAACTCGAGTTCCAATAATCTTCTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1360s21c1
Sequence:CCGGGCAGACCAAGAATTAGCAGAACTCGAGTTCTGCTAATTCTTGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017966.2-984s21c1
Sequence:CCGGAGGAGCCCAGATGACTATTATCTCGAGATAATAGTCATCTGGGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-1351s21c1
Sequence:CCGGGAGGAAATTGCAGACCAAGAACTCGAGTTCTTGGTCTGCAATTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017966.2-405s21c1
Sequence:CCGGACTGGCTTCTTACGGTTTAAACTCGAGTTTAAACCGTAAGAAGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032341
DDI2 MISSION shRNA Bacterial Glycerol Stock
DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011122    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-919s1c1
Sequence:CCGGCCATGTTCCTTCTCTATACTTCTCGAGAAGTATAGAGAAGGAACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011125    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-607s1c1
Sequence:CCGGCAGGCAAAGATAGAAGAAGATCTCGAGATCTTCTTCTATCTTTGCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011126    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-964s1c1
Sequence:CCGGCTGGGACTGGACATGCTTAAACTCGAGTTTAAGCATGTCCAGTCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011124    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-862s1c1
Sequence:CCGGCAGAAGATTATTGGAAGGGTACTCGAGTACCCTTCCAATAATCTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011123    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-583s1c1
Sequence:CCGGGCTGATCCCTTTGACCTTGAACTCGAGTTCAAGGTCAAAGGGATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032341.3-788s21c1
Sequence:CCGGGCCAAGTAGTGATGCTTTATACTCGAGTATAAAGCATCACTACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032341.3-888s21c1
Sequence:CCGGTGCAGAAAGGTGTAACATAATCTCGAGATTATGTTACACCTTTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032341.3-1366s21c1
Sequence:CCGGTCACTGGGAATGTCATCATTACTCGAGTAATGATGACATTCCCAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032341
DDI2 MISSION shRNA shRNA Plasmid DNA
DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011122    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-919s1c1
Sequence:CCGGCCATGTTCCTTCTCTATACTTCTCGAGAAGTATAGAGAAGGAACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011125    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-607s1c1
Sequence:CCGGCAGGCAAAGATAGAAGAAGATCTCGAGATCTTCTTCTATCTTTGCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011126    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-964s1c1
Sequence:CCGGCTGGGACTGGACATGCTTAAACTCGAGTTTAAGCATGTCCAGTCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011124    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-862s1c1
Sequence:CCGGCAGAAGATTATTGGAAGGGTACTCGAGTACCCTTCCAATAATCTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011123    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-583s1c1
Sequence:CCGGGCTGATCCCTTTGACCTTGAACTCGAGTTCAAGGTCAAAGGGATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032341.3-788s21c1
Sequence:CCGGGCCAAGTAGTGATGCTTTATACTCGAGTATAAAGCATCACTACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032341.3-888s21c1
Sequence:CCGGTGCAGAAAGGTGTAACATAATCTCGAGATTATGTTACACCTTTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032341.3-1366s21c1
Sequence:CCGGTCACTGGGAATGTCATCATTACTCGAGTAATGATGACATTCCCAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032341
DDI2 MISSION shRNA Lentiviral Transduction Particles
DNA-damage inducible 1 homolog 2 (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011122    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-919s1c1
Sequence:CCGGCCATGTTCCTTCTCTATACTTCTCGAGAAGTATAGAGAAGGAACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011125    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-607s1c1
Sequence:CCGGCAGGCAAAGATAGAAGAAGATCTCGAGATCTTCTTCTATCTTTGCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011126    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-964s1c1
Sequence:CCGGCTGGGACTGGACATGCTTAAACTCGAGTTTAAGCATGTCCAGTCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011124    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-862s1c1
Sequence:CCGGCAGAAGATTATTGGAAGGGTACTCGAGTACCCTTCCAATAATCTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011123    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032341.2-583s1c1
Sequence:CCGGGCTGATCCCTTTGACCTTGAACTCGAGTTCAAGGTCAAAGGGATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032341.3-788s21c1
Sequence:CCGGGCCAAGTAGTGATGCTTTATACTCGAGTATAAAGCATCACTACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032341.3-888s21c1
Sequence:CCGGTGCAGAAAGGTGTAACATAATCTCGAGATTATGTTACACCTTTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032341.3-1366s21c1
Sequence:CCGGTCACTGGGAATGTCATCATTACTCGAGTAATGATGACATTCCCAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)