EMAIL THIS PAGE TO A FRIEND

DDIT3

DNA-damage-inducible transcript 3

Synonyms: CEBPZ CHOP CHOP-10 CHOP10 GADD153
UniProtKB ID: P35638, F8VS99
Gene ID:
Human(1649) Summary: This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010]
Mouse(13198) DNA-damage inducible transcript 3
Rat(29467) DNA-damage inducible transcript 3
domestic guinea pig(101787388) DNA-damage-inducible transcript 3
naked mole-rat(101715873) DNA-damage-inducible transcript 3
sheep(541600) DNA-damage-inducible transcript 3
Zebrafish(561924) DNA-damage-inducible transcript 3
cow(777788) DNA-damage-inducible transcript 3
domestic cat(101081819) DNA-damage-inducible transcript 3
dog(607439) DNA-damage-inducible transcript 3
chicken(100857832) DNA-damage-inducible transcript 3
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500631 Anti-CHOP, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB1405706 Anti-DDIT3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA068416 Anti-DDIT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA058416 Anti-DDIT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
G6916 Anti-GADD153 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, microarray, western blot pricing
SAB4500632 Anti-GADD153 antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4504148 Anti-phospho-CHOP (pSer30) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301473 Anti-phospho-CHOP (pSer30) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
WH0001649M1 Monoclonal Anti-DDIT3 antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403729 Monoclonal Anti-DDIT3 antibody produced in mouse clone 2C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004083 Rosetta Predictions human pricing
NM_001109986 Rosetta Predictions rat pricing
NM_024134 Rosetta Predictions rat pricing
NM_007837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153013 predicted 654
2 SASI_Hs02_00336880 predicted 332
3 SASI_Hs01_00153015 predicted 475
4 SASI_Hs01_00153016 predicted 374
5 SASI_Hs01_00153017 predicted 236
6 SASI_Hs01_00153018 predicted 661
7 SASI_Hs01_00153019 predicted 644
8 SASI_Hs01_00153020 predicted 253
9 SASI_Hs01_00153021 predicted 573
10 SASI_Hs01_00153022 predicted 518
11 SASI_Hs01_00153014 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250952 predicted 455
2 SASI_Rn02_00250953 predicted 460
3 SASI_Rn02_00250954 predicted 412
4 SASI_Rn02_00250955 predicted 575
5 SASI_Rn02_00250956 predicted 498
6 SASI_Rn02_00250957 predicted 379
7 SASI_Rn02_00250958 predicted 400
8 SASI_Rn02_00250959 predicted 634
9 SASI_Rn02_00250960 predicted 408
10 SASI_Rn02_00250961 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108226 predicted 407
2 SASI_Rn01_00108228 predicted 408
3 SASI_Rn01_00108230 predicted 368
4 SASI_Rn02_00263853 predicted 527
5 SASI_Rn02_00263854 predicted 449
6 SASI_Rn01_00108233 predicted 327
7 SASI_Rn02_00263855 predicted 348
8 SASI_Rn02_00263856 predicted 586
9 SASI_Rn01_00108235 predicted 362
10 SASI_Rn02_00263857 predicted 498
11 SASI_Rn01_00108227 predicted 366
12 SASI_Rn01_00108229 predicted 529
13 SASI_Rn01_00108231 predicted 447
14 SASI_Rn01_00108232 predicted 331
15 SASI_Rn01_00108234 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085431 predicted 460
2 SASI_Mm01_00085432 predicted 412
3 SASI_Mm02_00312578 predicted 459
4 SASI_Mm01_00085433 predicted 544
5 SASI_Mm01_00085434 predicted 362
6 SASI_Mm01_00085435 predicted 331
7 SASI_Mm01_00085436 predicted 376
8 SASI_Mm01_00085437 predicted 401
9 SASI_Mm02_00312579 predicted 367
10 SASI_Mm01_00085440 predicted 452
11 SASI_Mm01_00085438 predicted 215
12 SASI_Mm01_00085439 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004083
VALIDATED
DDIT3 MISSION shRNA Bacterial Glycerol Stock
DNA-damage-inducible transcript 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-413s21c1
Sequence:CCGGAGAGCCCTCACTCTCCAGATTCTCGAGAATCTGGAGAGTGAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-339s21c1
Sequence:CCGGCACTCTTGACCCTGCTTCTCTCTCGAGAGAGAAGCAGGGTCAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-594s21c1
Sequence:CCGGTGAACGGCTCAAGCAGGAAATCTCGAGATTTCCTGCTTGAGCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-676s21c1
Sequence:CCGGCTGCACCAAGCATGAACAATTCTCGAGAATTGTTCATGCTTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-492s21c1
Sequence:CCGGACGGAAACAGAGTGGTCATTCCTCGAGGAATGACCACTCTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-260s21c1
Sequence:CCGGAGGTCCTGTCTTCAGATGAAACTCGAGTTTCATCTGAAGACAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-773s1c1
Sequence:CCGGGCCAATGATGTGACCCTCAATCTCGAGATTGAGGGTCACATCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-305s1c1
Sequence:CCGGCCTGGAAATGAAGAGGAAGAACTCGAGTTCTTCCTCTTCATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004083.3-291s1c1
Sequence:CCGGCCTATGTTTCACCTCCTGGAACTCGAGTTCCAGGAGGTGAAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-551s1c1
Sequence:CCGGGAACAGGAGAATGAAAGGAAACTCGAGTTTCCTTTCATTCTCCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-665s1c1
Sequence:CCGGCGAATGGTGAATCTGCACCAACTCGAGTTGGTGCAGATTCACCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004083
VALIDATED
DDIT3 MISSION shRNA shRNA Plasmid DNA
DNA-damage-inducible transcript 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-413s21c1
Sequence:CCGGAGAGCCCTCACTCTCCAGATTCTCGAGAATCTGGAGAGTGAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-339s21c1
Sequence:CCGGCACTCTTGACCCTGCTTCTCTCTCGAGAGAGAAGCAGGGTCAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-594s21c1
Sequence:CCGGTGAACGGCTCAAGCAGGAAATCTCGAGATTTCCTGCTTGAGCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-676s21c1
Sequence:CCGGCTGCACCAAGCATGAACAATTCTCGAGAATTGTTCATGCTTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-492s21c1
Sequence:CCGGACGGAAACAGAGTGGTCATTCCTCGAGGAATGACCACTCTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-260s21c1
Sequence:CCGGAGGTCCTGTCTTCAGATGAAACTCGAGTTTCATCTGAAGACAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-773s1c1
Sequence:CCGGGCCAATGATGTGACCCTCAATCTCGAGATTGAGGGTCACATCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-305s1c1
Sequence:CCGGCCTGGAAATGAAGAGGAAGAACTCGAGTTCTTCCTCTTCATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004083.3-291s1c1
Sequence:CCGGCCTATGTTTCACCTCCTGGAACTCGAGTTCCAGGAGGTGAAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-551s1c1
Sequence:CCGGGAACAGGAGAATGAAAGGAAACTCGAGTTTCCTTTCATTCTCCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-665s1c1
Sequence:CCGGCGAATGGTGAATCTGCACCAACTCGAGTTGGTGCAGATTCACCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004083
VALIDATED
DDIT3 MISSION shRNA Lentiviral Transduction Particles
DNA-damage-inducible transcript 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-413s21c1
Sequence:CCGGAGAGCCCTCACTCTCCAGATTCTCGAGAATCTGGAGAGTGAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-339s21c1
Sequence:CCGGCACTCTTGACCCTGCTTCTCTCTCGAGAGAGAAGCAGGGTCAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-594s21c1
Sequence:CCGGTGAACGGCTCAAGCAGGAAATCTCGAGATTTCCTGCTTGAGCCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-676s21c1
Sequence:CCGGCTGCACCAAGCATGAACAATTCTCGAGAATTGTTCATGCTTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004083.4-492s21c1
Sequence:CCGGACGGAAACAGAGTGGTCATTCCTCGAGGAATGACCACTCTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004083.4-260s21c1
Sequence:CCGGAGGTCCTGTCTTCAGATGAAACTCGAGTTTCATCTGAAGACAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-773s1c1
Sequence:CCGGGCCAATGATGTGACCCTCAATCTCGAGATTGAGGGTCACATCATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-305s1c1
Sequence:CCGGCCTGGAAATGAAGAGGAAGAACTCGAGTTCTTCCTCTTCATTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004083.3-291s1c1
Sequence:CCGGCCTATGTTTCACCTCCTGGAACTCGAGTTCCAGGAGGTGAAACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-551s1c1
Sequence:CCGGGAACAGGAGAATGAAAGGAAACTCGAGTTTCCTTTCATTCTCCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004083.3-665s1c1
Sequence:CCGGCGAATGGTGAATCTGCACCAACTCGAGTTGGTGCAGATTCACCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007837
VALIDATED
DDIT3 MISSION shRNA Bacterial Glycerol Stock
DNA-damage-inducible transcript 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-248s21c1
Sequence:CCGGGGTCCTGTCCTCAGATGAAATCTCGAGATTTCATCTGAGGACAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-694s21c1
Sequence:CCGGGTCTGTCTCTCCGGAAGTGTACTCGAGTACACTTCCGGAGAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-414s21c1
Sequence:CCGGGATTCCAGTCAGAGTTCTATGCTCGAGCATAGAACTCTGACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-569s21c1
Sequence:CCGGTGAAGAGAACGAGCGGCTCAACTCGAGTTGAGCCGCTCGTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-295s21c1
Sequence:CCGGGAAACGAAGAGGAAGAATCAACTCGAGTTGATTCTTCCTCTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007837.2-700s1c1
Sequence:CCGGCGGAAGTGTACCCAGCACCATCTCGAGATGGTGCTGGGTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-456s1c1
Sequence:CCGGAGGAAGAACTAGGAAACGGAACTCGAGTTCCGTTTCCTAGTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-290s1c1
Sequence:CCGGGAAACGAAGAGGAAGAATCAACTCGAGTTGATTCTTCCTCTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-627s1c1
Sequence:CCGGGCGGGCTCTGATCGACCGCATCTCGAGATGCGGTCGATCAGAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-501s1c1
Sequence:CCGGGCCTGGGAAGCAACGCATGAACTCGAGTTCATGCGTTGCTTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007837
VALIDATED
DDIT3 MISSION shRNA shRNA Plasmid DNA
DNA-damage-inducible transcript 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-248s21c1
Sequence:CCGGGGTCCTGTCCTCAGATGAAATCTCGAGATTTCATCTGAGGACAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-694s21c1
Sequence:CCGGGTCTGTCTCTCCGGAAGTGTACTCGAGTACACTTCCGGAGAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-414s21c1
Sequence:CCGGGATTCCAGTCAGAGTTCTATGCTCGAGCATAGAACTCTGACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-569s21c1
Sequence:CCGGTGAAGAGAACGAGCGGCTCAACTCGAGTTGAGCCGCTCGTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-295s21c1
Sequence:CCGGGAAACGAAGAGGAAGAATCAACTCGAGTTGATTCTTCCTCTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007837.2-700s1c1
Sequence:CCGGCGGAAGTGTACCCAGCACCATCTCGAGATGGTGCTGGGTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-456s1c1
Sequence:CCGGAGGAAGAACTAGGAAACGGAACTCGAGTTCCGTTTCCTAGTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-290s1c1
Sequence:CCGGGAAACGAAGAGGAAGAATCAACTCGAGTTGATTCTTCCTCTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-627s1c1
Sequence:CCGGGCGGGCTCTGATCGACCGCATCTCGAGATGCGGTCGATCAGAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-501s1c1
Sequence:CCGGGCCTGGGAAGCAACGCATGAACTCGAGTTCATGCGTTGCTTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007837
VALIDATED
DDIT3 MISSION shRNA Lentiviral Transduction Particles
DNA-damage-inducible transcript 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-248s21c1
Sequence:CCGGGGTCCTGTCCTCAGATGAAATCTCGAGATTTCATCTGAGGACAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-694s21c1
Sequence:CCGGGTCTGTCTCTCCGGAAGTGTACTCGAGTACACTTCCGGAGAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-414s21c1
Sequence:CCGGGATTCCAGTCAGAGTTCTATGCTCGAGCATAGAACTCTGACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-569s21c1
Sequence:CCGGTGAAGAGAACGAGCGGCTCAACTCGAGTTGAGCCGCTCGTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007837.3-295s21c1
Sequence:CCGGGAAACGAAGAGGAAGAATCAACTCGAGTTGATTCTTCCTCTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007837.2-700s1c1
Sequence:CCGGCGGAAGTGTACCCAGCACCATCTCGAGATGGTGCTGGGTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-456s1c1
Sequence:CCGGAGGAAGAACTAGGAAACGGAACTCGAGTTCCGTTTCCTAGTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-290s1c1
Sequence:CCGGGAAACGAAGAGGAAGAATCAACTCGAGTTGATTCTTCCTCTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-627s1c1
Sequence:CCGGGCGGGCTCTGATCGACCGCATCTCGAGATGCGGTCGATCAGAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007837.2-501s1c1
Sequence:CCGGGCCTGGGAAGCAACGCATGAACTCGAGTTCATGCGTTGCTTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks