EMAIL THIS PAGE TO A FRIEND

DDIT4L

DNA-damage-inducible transcript 4-like

117 Gene Product Result for
Synonyms: REDD2 Rtp801L
UniProtKB ID: Q96D03, B2R7C3
Gene ID:
Mouse(73284) DNA-damage-inducible transcript 4-like
Rat(140582) DNA-damage-inducible transcript 4-like
domestic guinea pig(100728417) DNA-damage-inducible transcript 4-like
naked mole-rat(101714035) DNA-damage-inducible transcript 4-like
sheep(101109448) DNA-damage-inducible transcript 4-like
dog(487877) DNA-damage-inducible transcript 4-like
cow(510906) DNA-damage-inducible transcript 4-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145244 Rosetta Predictions human pricing
NM_080399 Rosetta Predictions rat pricing
XM_579604 Rosetta Predictions rat pricing
NM_030143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193228 predicted 344
2 SASI_Hs01_00193230 predicted 463
3 SASI_Hs01_00193231 predicted 572
4 SASI_Hs02_00365085 predicted 823
5 SASI_Hs01_00193232 predicted 381
6 SASI_Hs01_00193233 predicted 303
7 SASI_Hs01_00193234 predicted 838
8 SASI_Hs01_00193235 predicted 568
9 SASI_Hs01_00193236 predicted 830
10 SASI_Hs01_00193237 predicted 407
11 SASI_Hs01_00193229 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111051 predicted 594
2 SASI_Rn01_00111052 predicted 763
3 SASI_Rn02_00267225 predicted 659
4 SASI_Rn01_00111053 predicted 445
5 SASI_Rn01_00111055 predicted 797
6 SASI_Rn01_00111056 predicted 532
7 SASI_Rn01_00111057 predicted 751
8 SASI_Rn01_00111058 predicted 834
9 SASI_Rn02_00267226 predicted 620
10 SASI_Rn02_00267227 predicted 572
11 SASI_Rn01_00111054 predicted 532
12 SASI_Rn01_00111059 predicted 699
13 SASI_Rn01_00111060 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153110 predicted 442
2 SASI_Rn01_00153111 predicted 412
3 SASI_Rn01_00153112 predicted 404
4 SASI_Rn01_00153113 predicted 449
5 SASI_Rn01_00153114 predicted 407
6 SASI_Rn01_00153115 predicted 476
7 SASI_Rn01_00153116 predicted 436
8 SASI_Rn01_00153117 predicted 448
9 SASI_Rn01_00153118 predicted 411
10 SASI_Rn01_00153119 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163951 predicted 505
2 SASI_Mm01_00163952 predicted 586
3 SASI_Mm01_00163953 predicted 590
4 SASI_Mm01_00163954 predicted 284
5 SASI_Mm01_00163955 predicted 242
6 SASI_Mm01_00163956 predicted 599
7 SASI_Mm01_00163957 predicted 417
8 SASI_Mm01_00163958 predicted 458
9 SASI_Mm02_00336549 predicted 442
10 SASI_Mm01_00163959 predicted 335
11 SASI_Mm01_00163960 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145244
DDIT4L MISSION shRNA Bacterial Glycerol Stock
DNA-damage-inducible transcript 4-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145244.2-808s21c1
Sequence:CCGGATTTCATGATTGGGTAGTAAACTCGAGTTTACTACCCAATCATGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145244.2-837s21c1
Sequence:CCGGGCTAGTCAGCTAAAGTCATTTCTCGAGAAATGACTTTAGCTGACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-351s1c1
Sequence:CCGGGAGGAATCAACTTGCCAGAATCTCGAGATTCTGGCAAGTTGATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-2242s1c1
Sequence:CCGGGCCAGTGTTCTAACAAACTAACTCGAGTTAGTTTGTTAGAACACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-458s1c1
Sequence:CCGGCCAGAGAATTGCTCAAGATGTCTCGAGACATCTTGAGCAATTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-753s1c1
Sequence:CCGGCTGATTGGAACAACAGTGATTCTCGAGAATCACTGTTGTTCCAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-528s1c1
Sequence:CCGGCACGTGAACTTGGAAATTGAACTCGAGTTCAATTTCCAAGTTCACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-1629s1c1
Sequence:CCGGCCTCTCTGATTCACTTAGTAACTCGAGTTACTAAGTGAATCAGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-1628s1c1
Sequence:CCGGCCCTCTCTGATTCACTTAGTACTCGAGTACTAAGTGAATCAGAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145244
DDIT4L MISSION shRNA shRNA Plasmid DNA
DNA-damage-inducible transcript 4-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145244.2-808s21c1
Sequence:CCGGATTTCATGATTGGGTAGTAAACTCGAGTTTACTACCCAATCATGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145244.2-837s21c1
Sequence:CCGGGCTAGTCAGCTAAAGTCATTTCTCGAGAAATGACTTTAGCTGACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-351s1c1
Sequence:CCGGGAGGAATCAACTTGCCAGAATCTCGAGATTCTGGCAAGTTGATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-2242s1c1
Sequence:CCGGGCCAGTGTTCTAACAAACTAACTCGAGTTAGTTTGTTAGAACACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-458s1c1
Sequence:CCGGCCAGAGAATTGCTCAAGATGTCTCGAGACATCTTGAGCAATTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-753s1c1
Sequence:CCGGCTGATTGGAACAACAGTGATTCTCGAGAATCACTGTTGTTCCAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-528s1c1
Sequence:CCGGCACGTGAACTTGGAAATTGAACTCGAGTTCAATTTCCAAGTTCACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-1629s1c1
Sequence:CCGGCCTCTCTGATTCACTTAGTAACTCGAGTTACTAAGTGAATCAGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-1628s1c1
Sequence:CCGGCCCTCTCTGATTCACTTAGTACTCGAGTACTAAGTGAATCAGAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145244
DDIT4L MISSION shRNA Lentiviral Transduction Particles
DNA-damage-inducible transcript 4-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145244.2-808s21c1
Sequence:CCGGATTTCATGATTGGGTAGTAAACTCGAGTTTACTACCCAATCATGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145244.2-837s21c1
Sequence:CCGGGCTAGTCAGCTAAAGTCATTTCTCGAGAAATGACTTTAGCTGACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-351s1c1
Sequence:CCGGGAGGAATCAACTTGCCAGAATCTCGAGATTCTGGCAAGTTGATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-2242s1c1
Sequence:CCGGGCCAGTGTTCTAACAAACTAACTCGAGTTAGTTTGTTAGAACACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-458s1c1
Sequence:CCGGCCAGAGAATTGCTCAAGATGTCTCGAGACATCTTGAGCAATTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-753s1c1
Sequence:CCGGCTGATTGGAACAACAGTGATTCTCGAGAATCACTGTTGTTCCAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145244.2-528s1c1
Sequence:CCGGCACGTGAACTTGGAAATTGAACTCGAGTTCAATTTCCAAGTTCACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-1629s1c1
Sequence:CCGGCCTCTCTGATTCACTTAGTAACTCGAGTTACTAAGTGAATCAGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145244.2-1628s1c1
Sequence:CCGGCCCTCTCTGATTCACTTAGTACTCGAGTACTAAGTGAATCAGAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030143
VALIDATED
DDIT4L MISSION shRNA Bacterial Glycerol Stock
DNA-damage-inducible transcript 4-like
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030143.3-1106s21c1
Sequence:CCGGAGATCCACTTTGCCTAATTTGCTCGAGCAAATTAGGCAAAGTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.3-673s21c1
Sequence:CCGGTCGCTTCTCCTCAGGCCTTAACTCGAGTTAAGGCCTGAGGAGAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.4-867s21c1
Sequence:CCGGCCCTAATGAGTGGATAATAAACTCGAGTTTATTATCCACTCATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.3-327s21c1
Sequence:CCGGACCTCAACGAGGTGGTATTTGCTCGAGCAAATACCACCTCGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030143.3-712s21c4
Sequence:CCGGCTCAGGATTTCGACTTGTGAACTCGAGTTCACAAGTCGAAATCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030143.3-290s21c1
Sequence:CCGGGATTTCGACTACTGGGATTATCTCGAGATAATCCCAGTAGTCGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.4-414s21c1
Sequence:CCGGGAGACAACATGCCAGAATTTGCTCGAGCAAATTCTGGCATGTTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-2297s1c1
Sequence:CCGGGCCTGATAGTTACTGGTCTTACTCGAGTAAGACCAGTAACTATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-292s1c1
Sequence:CCGGGATTTCGACTACTGGGATTATCTCGAGATAATCCCAGTAGTCGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-750s1c1
Sequence:CCGGCCTGATTGGAACGACAGTCATCTCGAGATGACTGTCGTTCCAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-714s1c1
Sequence:CCGGCTCAGGATTTCGACTTGTGAACTCGAGTTCACAAGTCGAAATCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030143.2-2219s1c1
Sequence:CCGGGCCTTCAGTATGAGTTTGTATCTCGAGATACAAACTCATACTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030143
VALIDATED
DDIT4L MISSION shRNA shRNA Plasmid DNA
DNA-damage-inducible transcript 4-like
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030143.3-1106s21c1
Sequence:CCGGAGATCCACTTTGCCTAATTTGCTCGAGCAAATTAGGCAAAGTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.3-673s21c1
Sequence:CCGGTCGCTTCTCCTCAGGCCTTAACTCGAGTTAAGGCCTGAGGAGAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.4-867s21c1
Sequence:CCGGCCCTAATGAGTGGATAATAAACTCGAGTTTATTATCCACTCATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.3-327s21c1
Sequence:CCGGACCTCAACGAGGTGGTATTTGCTCGAGCAAATACCACCTCGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030143.3-712s21c4
Sequence:CCGGCTCAGGATTTCGACTTGTGAACTCGAGTTCACAAGTCGAAATCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030143.3-290s21c1
Sequence:CCGGGATTTCGACTACTGGGATTATCTCGAGATAATCCCAGTAGTCGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.4-414s21c1
Sequence:CCGGGAGACAACATGCCAGAATTTGCTCGAGCAAATTCTGGCATGTTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-2297s1c1
Sequence:CCGGGCCTGATAGTTACTGGTCTTACTCGAGTAAGACCAGTAACTATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-292s1c1
Sequence:CCGGGATTTCGACTACTGGGATTATCTCGAGATAATCCCAGTAGTCGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-750s1c1
Sequence:CCGGCCTGATTGGAACGACAGTCATCTCGAGATGACTGTCGTTCCAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-714s1c1
Sequence:CCGGCTCAGGATTTCGACTTGTGAACTCGAGTTCACAAGTCGAAATCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030143.2-2219s1c1
Sequence:CCGGGCCTTCAGTATGAGTTTGTATCTCGAGATACAAACTCATACTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030143
VALIDATED
DDIT4L MISSION shRNA Lentiviral Transduction Particles
DNA-damage-inducible transcript 4-like
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030143.3-1106s21c1
Sequence:CCGGAGATCCACTTTGCCTAATTTGCTCGAGCAAATTAGGCAAAGTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.3-673s21c1
Sequence:CCGGTCGCTTCTCCTCAGGCCTTAACTCGAGTTAAGGCCTGAGGAGAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.4-867s21c1
Sequence:CCGGCCCTAATGAGTGGATAATAAACTCGAGTTTATTATCCACTCATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.3-327s21c1
Sequence:CCGGACCTCAACGAGGTGGTATTTGCTCGAGCAAATACCACCTCGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030143.3-712s21c4
Sequence:CCGGCTCAGGATTTCGACTTGTGAACTCGAGTTCACAAGTCGAAATCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030143.3-290s21c1
Sequence:CCGGGATTTCGACTACTGGGATTATCTCGAGATAATCCCAGTAGTCGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030143.4-414s21c1
Sequence:CCGGGAGACAACATGCCAGAATTTGCTCGAGCAAATTCTGGCATGTTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-2297s1c1
Sequence:CCGGGCCTGATAGTTACTGGTCTTACTCGAGTAAGACCAGTAACTATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-292s1c1
Sequence:CCGGGATTTCGACTACTGGGATTATCTCGAGATAATCCCAGTAGTCGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-750s1c1
Sequence:CCGGCCTGATTGGAACGACAGTCATCTCGAGATGACTGTCGTTCCAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030143.2-714s1c1
Sequence:CCGGCTCAGGATTTCGACTTGTGAACTCGAGTTCACAAGTCGAAATCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030143.2-2219s1c1
Sequence:CCGGGCCTTCAGTATGAGTTTGTATCTCGAGATACAAACTCATACTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)