EMAIL THIS PAGE TO A FRIEND
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015086 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007281 MISSION® esiRNA esiRNA targeting human DDN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015086 Rosetta Predictions human pricing
NM_030993 Rosetta Predictions rat pricing
NM_001013741 Rosetta Predictions mouse pricing
XM_619356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096004 predicted 376
2 SASI_Hs01_00096005 predicted 2373
3 SASI_Hs01_00096006 predicted 2356
4 SASI_Hs01_00096007 predicted 804
5 SASI_Hs01_00096008 predicted 1246
6 SASI_Hs01_00096009 predicted 2297
7 SASI_Hs01_00096010 predicted 694
8 SASI_Hs01_00096011 predicted 1145
9 SASI_Hs01_00096012 predicted 2241
10 SASI_Hs01_00096013 predicted 2334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060882 predicted 1516
2 SASI_Rn01_00060883 predicted 2019
3 SASI_Rn01_00060884 predicted 2498
4 SASI_Rn01_00060885 predicted 952
5 SASI_Rn01_00060886 predicted 1206
6 SASI_Rn01_00060887 predicted 2501
7 SASI_Rn01_00060889 predicted 1851
8 SASI_Rn01_00060890 predicted 1515
9 SASI_Rn01_00060891 predicted 2444
10 SASI_Rn02_00264162 predicted 2456
11 SASI_Rn01_00060888 predicted 2592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287269 predicted 1094
2 SASI_Mm02_00287270 predicted 1147
3 SASI_Mm02_00287271 predicted 1342
4 SASI_Mm02_00287272 predicted 2613
5 SASI_Mm02_00287273 predicted 1650
6 SASI_Mm02_00287274 predicted 783
7 SASI_Mm02_00287275 predicted 2659
8 SASI_Mm02_00287276 predicted 1243
9 SASI_Mm02_00287277 predicted 1076
10 SASI_Mm02_00287278 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270507 predicted 1097
2 SASI_Mm01_00270508 predicted 1153
3 SASI_Mm01_00270509 predicted 1348
4 SASI_Mm01_00270510 predicted 1657
5 SASI_Mm01_00270511 predicted 794
6 SASI_Mm01_00270512 predicted 2660
7 SASI_Mm01_00270513 predicted 1244
8 SASI_Mm01_00270514 predicted 1080
9 SASI_Mm01_00270515 predicted 1979
10 SASI_Mm01_00270516 predicted 2670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015086
DDN MISSION shRNA Bacterial Glycerol Stock
dendrin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-100s21c1
Sequence:CCGGGTGCAGAAGTCCAAGCTATTGCTCGAGCAATAGCTTGGACTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-123s21c1
Sequence:CCGGGATAGAAGTGAAGACTATTTCCTCGAGGAAATAGTCTTCACTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-697s21c1
Sequence:CCGGTACGTGGCTCCACCTTCTTACCTCGAGGTAAGAAGGTGGAGCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015086.1-2721s21c1
Sequence:CCGGTCCAGGCCTCCTGGTATATAACTCGAGTTATATACCAGGAGGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-1397s21c1
Sequence:CCGGTAGTGATACGATCCCAATATGCTCGAGCATATTGGGATCGTATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015086
DDN MISSION shRNA shRNA Plasmid DNA
dendrin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-100s21c1
Sequence:CCGGGTGCAGAAGTCCAAGCTATTGCTCGAGCAATAGCTTGGACTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-123s21c1
Sequence:CCGGGATAGAAGTGAAGACTATTTCCTCGAGGAAATAGTCTTCACTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-697s21c1
Sequence:CCGGTACGTGGCTCCACCTTCTTACCTCGAGGTAAGAAGGTGGAGCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015086.1-2721s21c1
Sequence:CCGGTCCAGGCCTCCTGGTATATAACTCGAGTTATATACCAGGAGGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-1397s21c1
Sequence:CCGGTAGTGATACGATCCCAATATGCTCGAGCATATTGGGATCGTATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015086
DDN MISSION shRNA Lentiviral Transduction Particles
dendrin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-100s21c1
Sequence:CCGGGTGCAGAAGTCCAAGCTATTGCTCGAGCAATAGCTTGGACTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-123s21c1
Sequence:CCGGGATAGAAGTGAAGACTATTTCCTCGAGGAAATAGTCTTCACTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-697s21c1
Sequence:CCGGTACGTGGCTCCACCTTCTTACCTCGAGGTAAGAAGGTGGAGCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015086.1-2721s21c1
Sequence:CCGGTCCAGGCCTCCTGGTATATAACTCGAGTTATATACCAGGAGGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015086.1-1397s21c1
Sequence:CCGGTAGTGATACGATCCCAATATGCTCGAGCATATTGGGATCGTATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013741
DDN MISSION shRNA Bacterial Glycerol Stock
dendrin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1090s1c1
Sequence:CCGGCAGTGCTGGCGATAGTCATTCCTCGAGGAATGACTATCGCCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1478s1c1
Sequence:CCGGGCCACATGCGTGGTGATAAAGCTCGAGCTTTATCACCACGCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1653s1c1
Sequence:CCGGTGTTGAGCAGTCGAGTCTTAACTCGAGTTAAGACTCGACTGCTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-217s1c1
Sequence:CCGGGATTGAAGTGAAGACTATTTCCTCGAGGAAATAGTCTTCACTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013741.1-2717s1c1
Sequence:CCGGGTGGACCTCAGAGTAACTATTCTCGAGAATAGTTACTCTGAGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013741
DDN MISSION shRNA shRNA Plasmid DNA
dendrin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1090s1c1
Sequence:CCGGCAGTGCTGGCGATAGTCATTCCTCGAGGAATGACTATCGCCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1478s1c1
Sequence:CCGGGCCACATGCGTGGTGATAAAGCTCGAGCTTTATCACCACGCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1653s1c1
Sequence:CCGGTGTTGAGCAGTCGAGTCTTAACTCGAGTTAAGACTCGACTGCTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-217s1c1
Sequence:CCGGGATTGAAGTGAAGACTATTTCCTCGAGGAAATAGTCTTCACTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013741.1-2717s1c1
Sequence:CCGGGTGGACCTCAGAGTAACTATTCTCGAGAATAGTTACTCTGAGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013741
DDN MISSION shRNA Lentiviral Transduction Particles
dendrin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1090s1c1
Sequence:CCGGCAGTGCTGGCGATAGTCATTCCTCGAGGAATGACTATCGCCAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1478s1c1
Sequence:CCGGGCCACATGCGTGGTGATAAAGCTCGAGCTTTATCACCACGCATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-1653s1c1
Sequence:CCGGTGTTGAGCAGTCGAGTCTTAACTCGAGTTAAGACTCGACTGCTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013741.1-217s1c1
Sequence:CCGGGATTGAAGTGAAGACTATTTCCTCGAGGAAATAGTCTTCACTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013741.1-2717s1c1
Sequence:CCGGGTGGACCTCAGAGTAACTATTCTCGAGAATAGTTACTCTGAGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks