EMAIL THIS PAGE TO A FRIEND

DDO

D-aspartate oxidase

Synonyms: DASOX DDO-1 DDO-2
UniProtKB ID: Q99489, A8KAG4, Q5JXM4, Q5JXM5, Q5JXM6, Q8N552
Gene ID:
Human(8528) Summary: The protein encoded by this gene is a peroxisomal flavoprotein that catalyzes the oxidative deamination of D-aspartate and N-methyl D-aspartate. Flavin adenine dinucleotide or 6-hydroxyflavin adenine dinucleotide can serve as the cofactor in this reaction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(70503) D-aspartate oxidase
Rat(685325) D-aspartate oxidase
domestic guinea pig(100716707) D-aspartate oxidase
naked mole-rat(101707243) D-aspartate oxidase
sheep(101111973) D-aspartate oxidase
chicken(770953) D-aspartate oxidase
cow(280763) D-aspartate oxidase
Horse(100072326) D-aspartate oxidase
domestic cat(101081048) D-aspartate oxidase
dog(475026) D-aspartate oxidase
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223801 MISSION® esiRNA esiRNA targeting human DDO human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003649 Rosetta Predictions human pricing
NM_004032 Rosetta Predictions human pricing
NM_001109465 Rosetta Predictions rat pricing
NM_027442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052428 predicted 934
2 SASI_Hs01_00052429 predicted 843
3 SASI_Hs01_00052430 predicted 844
4 SASI_Hs01_00052431 predicted 882
5 SASI_Hs01_00052432 predicted 836
6 SASI_Hs01_00052433 predicted 887
7 SASI_Hs01_00052434 predicted 953
8 SASI_Hs01_00052435 predicted 837
9 SASI_Hs01_00052436 predicted 945
10 SASI_Hs01_00052437 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231972 predicted 756
2 SASI_Hs01_00231973 predicted 659
3 SASI_Hs01_00231974 predicted 662
4 SASI_Hs01_00231975 predicted 703
5 SASI_Hs01_00231976 predicted 657
6 SASI_Hs01_00231977 predicted 710
7 SASI_Hs01_00231978 predicted 774
8 SASI_Hs01_00231979 predicted 654
9 SASI_Hs01_00231980 predicted 765
10 SASI_Hs01_00231981 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248667 predicted 1037
2 SASI_Rn02_00248668 predicted 448
3 SASI_Rn02_00248669 predicted 453
4 SASI_Rn02_00248670 predicted 276
5 SASI_Rn02_00248671 predicted 1045
6 SASI_Rn02_00248672 predicted 318
7 SASI_Rn02_00248673 predicted 551
8 SASI_Rn02_00248674 predicted 815
9 SASI_Rn02_00248675 predicted 809
10 SASI_Rn02_00248676 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051186 predicted 352
2 SASI_Mm01_00051187 predicted 464
3 SASI_Mm01_00051188 predicted 1121
4 SASI_Mm01_00051189 predicted 1136
5 SASI_Mm01_00051190 predicted 821
6 SASI_Mm01_00051191 predicted 1346
7 SASI_Mm01_00051192 predicted 1249
8 SASI_Mm01_00051193 predicted 1232
9 SASI_Mm02_00332195 predicted 1187
10 SASI_Mm02_00332196 predicted 785
11 SASI_Mm01_00051194 predicted 450
12 SASI_Mm01_00051195 predicted 1334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003649
DDO MISSION shRNA Bacterial Glycerol Stock
D-aspartate oxidase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003649.2-566s21c1
Sequence:CCGGTGGACACTCACTCGGCGAATACTCGAGTATTCGCCGAGTGAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003649.2-1435s21c1
Sequence:CCGGATTAATGGCATAGGGCATAAACTCGAGTTTATGCCCTATGCCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003649.2-362s21c1
Sequence:CCGGGTATCAGGTTGGCAGATATTTCTCGAGAAATATCTGCCAACCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003649.2-1514s21c1
Sequence:CCGGCAAGGACCTATGCAGATTTATCTCGAGATAAATCTGCATAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-183s1c1
Sequence:CCGGCCATCATTTCAGACAAGTTTACTCGAGTAAACTTGTCTGAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-296s1c1
Sequence:CCGGGAAACCTTTAATCACCTCTTTCTCGAGAAAGAGGTGATTAAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-840s1c1
Sequence:CCGGGCAGAGAGATTCTTTCCCGATCTCGAGATCGGGAAAGAATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-1093s1c1
Sequence:CCGGCATTCCCAAGTCAAACCTGTACTCGAGTACAGGTTTGACTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-610s1c1
Sequence:CCGGGTCCTTTGACATCGTGGTCAACTCGAGTTGACCACGATGTCAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003649
DDO MISSION shRNA shRNA Plasmid DNA
D-aspartate oxidase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003649.2-566s21c1
Sequence:CCGGTGGACACTCACTCGGCGAATACTCGAGTATTCGCCGAGTGAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003649.2-1435s21c1
Sequence:CCGGATTAATGGCATAGGGCATAAACTCGAGTTTATGCCCTATGCCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003649.2-362s21c1
Sequence:CCGGGTATCAGGTTGGCAGATATTTCTCGAGAAATATCTGCCAACCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003649.2-1514s21c1
Sequence:CCGGCAAGGACCTATGCAGATTTATCTCGAGATAAATCTGCATAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-183s1c1
Sequence:CCGGCCATCATTTCAGACAAGTTTACTCGAGTAAACTTGTCTGAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-296s1c1
Sequence:CCGGGAAACCTTTAATCACCTCTTTCTCGAGAAAGAGGTGATTAAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-840s1c1
Sequence:CCGGGCAGAGAGATTCTTTCCCGATCTCGAGATCGGGAAAGAATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-1093s1c1
Sequence:CCGGCATTCCCAAGTCAAACCTGTACTCGAGTACAGGTTTGACTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-610s1c1
Sequence:CCGGGTCCTTTGACATCGTGGTCAACTCGAGTTGACCACGATGTCAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003649
DDO MISSION shRNA Lentiviral Transduction Particles
D-aspartate oxidase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003649.2-566s21c1
Sequence:CCGGTGGACACTCACTCGGCGAATACTCGAGTATTCGCCGAGTGAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003649.2-1435s21c1
Sequence:CCGGATTAATGGCATAGGGCATAAACTCGAGTTTATGCCCTATGCCATTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003649.2-362s21c1
Sequence:CCGGGTATCAGGTTGGCAGATATTTCTCGAGAAATATCTGCCAACCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003649.2-1514s21c1
Sequence:CCGGCAAGGACCTATGCAGATTTATCTCGAGATAAATCTGCATAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-183s1c1
Sequence:CCGGCCATCATTTCAGACAAGTTTACTCGAGTAAACTTGTCTGAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-296s1c1
Sequence:CCGGGAAACCTTTAATCACCTCTTTCTCGAGAAAGAGGTGATTAAAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-840s1c1
Sequence:CCGGGCAGAGAGATTCTTTCCCGATCTCGAGATCGGGAAAGAATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-1093s1c1
Sequence:CCGGCATTCCCAAGTCAAACCTGTACTCGAGTACAGGTTTGACTTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003649.2-610s1c1
Sequence:CCGGGTCCTTTGACATCGTGGTCAACTCGAGTTGACCACGATGTCAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027442
DDO MISSION shRNA Bacterial Glycerol Stock
D-aspartate oxidase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.5-358s1c1
Sequence:CCGGGTATCTGGTTGGCAGATATTCCTCGAGGAATATCTGCCAACCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-878s21c1
Sequence:CCGGTCCACAGAGCCTACGACATAACTCGAGTTATGTCGTAGGCTCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-220s21c1
Sequence:CCGGGTAGCGGCTGGGATGCTTATTCTCGAGAATAAGCATCCCAGCCGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027442.5-2152s21c1
Sequence:CCGGATGCGACCTAGGAGCTAATTTCTCGAGAAATTAGCTCCTAGGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-131s21c1
Sequence:CCGGTGTCTACTGCAGCATGCATTTCTCGAGAAATGCATGCTGCAGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-269s21c1
Sequence:CCGGCCACACAGAAGCGATGGTTTACTCGAGTAAACCATCGCTTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-256s1c1
Sequence:CCGGGCGATGGTTTAGAGAGACCTTCTCGAGAAGGTCTCTCTAAACCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-119s1c1
Sequence:CCGGGCATGCATTTCCCAACTGGTTCTCGAGAACCAGTTGGGAAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-1031s1c1
Sequence:CCGGCTGGTGATGGAGTGTATCCATCTCGAGATGGATACACTCCATCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027442
DDO MISSION shRNA shRNA Plasmid DNA
D-aspartate oxidase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.5-358s1c1
Sequence:CCGGGTATCTGGTTGGCAGATATTCCTCGAGGAATATCTGCCAACCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-878s21c1
Sequence:CCGGTCCACAGAGCCTACGACATAACTCGAGTTATGTCGTAGGCTCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-220s21c1
Sequence:CCGGGTAGCGGCTGGGATGCTTATTCTCGAGAATAAGCATCCCAGCCGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027442.5-2152s21c1
Sequence:CCGGATGCGACCTAGGAGCTAATTTCTCGAGAAATTAGCTCCTAGGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-131s21c1
Sequence:CCGGTGTCTACTGCAGCATGCATTTCTCGAGAAATGCATGCTGCAGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-269s21c1
Sequence:CCGGCCACACAGAAGCGATGGTTTACTCGAGTAAACCATCGCTTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-256s1c1
Sequence:CCGGGCGATGGTTTAGAGAGACCTTCTCGAGAAGGTCTCTCTAAACCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-119s1c1
Sequence:CCGGGCATGCATTTCCCAACTGGTTCTCGAGAACCAGTTGGGAAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-1031s1c1
Sequence:CCGGCTGGTGATGGAGTGTATCCATCTCGAGATGGATACACTCCATCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027442
DDO MISSION shRNA Lentiviral Transduction Particles
D-aspartate oxidase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.5-358s1c1
Sequence:CCGGGTATCTGGTTGGCAGATATTCCTCGAGGAATATCTGCCAACCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-878s21c1
Sequence:CCGGTCCACAGAGCCTACGACATAACTCGAGTTATGTCGTAGGCTCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-220s21c1
Sequence:CCGGGTAGCGGCTGGGATGCTTATTCTCGAGAATAAGCATCCCAGCCGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027442.5-2152s21c1
Sequence:CCGGATGCGACCTAGGAGCTAATTTCTCGAGAAATTAGCTCCTAGGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-131s21c1
Sequence:CCGGTGTCTACTGCAGCATGCATTTCTCGAGAAATGCATGCTGCAGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027442.5-269s21c1
Sequence:CCGGCCACACAGAAGCGATGGTTTACTCGAGTAAACCATCGCTTCTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202244    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-256s1c1
Sequence:CCGGGCGATGGTTTAGAGAGACCTTCTCGAGAAGGTCTCTCTAAACCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-119s1c1
Sequence:CCGGGCATGCATTTCCCAACTGGTTCTCGAGAACCAGTTGGGAAATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027442.3-1031s1c1
Sequence:CCGGCTGGTGATGGAGTGTATCCATCTCGAGATGGATACACTCCATCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks