EMAIL THIS PAGE TO A FRIEND

DDOST

dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)

74 Gene Product Result for
Synonyms: AGER1 CDG1R OKSWcl45 OST OST48 WBP1
UniProtKB ID: P39656, B2RDQ4, O43244, Q5VWA5, Q8NI93, Q9BUI2
Gene ID:
Human(1650) Summary: This gene encodes a component of the oligosaccharyltransferase complex which catalyzes the transfer of high-mannose oligosaccharides to asparagine residues on nascent polypeptides in the lumen of the rough endoplasmic reticulum. The protein complex co-purifies with ribosomes. The product of this gene is also implicated in the processing of advanced glycation endproducts (AGEs), which form from non-enzymatic reactions between sugars and proteins or lipids and are associated with aging and hyperglycemia. [provided by RefSeq, Jul 2008]
Mouse(13200) dolichyl-di-phosphooligosaccharide-protein glycotransferase
Rat(313648) dolichyl-diphosphooligosaccharide-protein glycosyltransferase
Zebrafish(406408) dolichyl-diphosphooligosaccharide-protein glycosyltransferase
chicken(425542) dolichyl-diphosphooligosaccharide--protein glycosyltransferase
cow(510682) dolichyl-diphosphooligosaccharide--protein glycosyltransferase
domestic cat(101093032) dolichyl-diphosphooligosaccharide--protein glycosyltransferase
dog(404012) dolichyl-diphosphooligosaccharide--protein glycosyltransferase
sheep(100037660) dolichyl-diphosphooligosaccharide--protein glycosyltransferase
naked mole-rat(101716383) dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
domestic guinea pig(100719976) dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005216 Rosetta Predictions human pricing
NM_001012104 Rosetta Predictions rat pricing
XM_575938 Rosetta Predictions rat pricing
NM_007838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339198 predicted 413
2 SASI_Hs01_00119745 predicted 889
3 SASI_Hs01_00119746 predicted 603
4 SASI_Hs01_00119749 predicted 576
5 SASI_Hs01_00119750 predicted 707
6 SASI_Hs01_00119752 predicted 985
7 SASI_Hs02_00339199 predicted 1255
8 SASI_Hs02_00339200 predicted 276
9 SASI_Hs02_00339201 predicted 606
10 SASI_Hs02_00339202 predicted 1292
11 SASI_Hs01_00119747 predicted 392
12 SASI_Hs01_00119748 predicted 477
13 SASI_Hs01_00119751 predicted 1380
14 SASI_Hs01_00119753 predicted 1094
15 SASI_Hs01_00119754 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108084 predicted 918
2 SASI_Rn01_00108085 predicted 796
3 SASI_Rn01_00108087 predicted 1199
4 SASI_Rn01_00108088 predicted 625
5 SASI_Rn02_00200250 predicted 1065
6 SASI_Rn01_00108089 predicted 1284
7 SASI_Rn01_00108090 predicted 911
8 SASI_Rn01_00108091 predicted 380
9 SASI_Rn01_00108092 predicted 961
10 SASI_Rn01_00108093 predicted 299
11 SASI_Rn01_00108086 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137099 predicted 596
2 SASI_Rn01_00137100 predicted 514
3 SASI_Rn01_00137101 predicted 354
4 SASI_Rn01_00137102 predicted 558
5 SASI_Rn01_00137103 predicted 499
6 SASI_Rn01_00137104 predicted 425
7 SASI_Rn01_00137105 predicted 676
8 SASI_Rn01_00137106 predicted 474
9 SASI_Rn01_00137107 predicted 713
10 SASI_Rn01_00137108 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047714 predicted 1813
2 SASI_Mm02_00312580 predicted 638
3 SASI_Mm01_00047715 predicted 931
4 SASI_Mm02_00312581 predicted 1848
5 SASI_Mm01_00047716 predicted 1372
6 SASI_Mm01_00047718 predicted 480
7 SASI_Mm01_00047719 predicted 844
8 SASI_Mm01_00047720 predicted 757
9 SASI_Mm02_00312582 predicted 1088
10 SASI_Mm01_00047722 predicted 304
11 SASI_Mm01_00047717 predicted 535
12 SASI_Mm01_00047721 predicted 769
13 SASI_Mm01_00047723 predicted 1143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005216
VALIDATED
DDOST MISSION shRNA Bacterial Glycerol Stock
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-1089s1c1
Sequence:CCGGCCCTTTGATGGCGATGACATTCTCGAGAATGTCATCGCCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-1202s1c1
Sequence:CCGGGTATGGTGTATTCCAGTTTAACTCGAGTTAAACTGGAATACACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-270s1c1
Sequence:CCGGCTCACATTCAAGACCGCTGATCTCGAGATCAGCGGTCTTGAATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005216.3-601s1c1
Sequence:CCGGCAACCATCGTTGGGAAATCATCTCGAGATGATTTCCCAACGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005216.3-729s1c1
Sequence:CCGGGACAAGCCTATCACCCAGTATCTCGAGATACTGGGTGATAGGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-421s21c1
Sequence:CCGGTCTATGACAATCTCATCATTTCTCGAGAAATGATGAGATTGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005216.4-822s21c1
Sequence:CCGGGACAAGCCTATCACCCAGTATCTCGAGATACTGGGTGATAGGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005216.4-1695s21c1
Sequence:CCGGTTTCCACTTTGAATTGCTAAACTCGAGTTTAGCAATTCAAAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-1286s21c1
Sequence:CCGGGCCCGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-1149s21c1
Sequence:CCGGGTGATCCAGCAGCTCTCAAATCTCGAGATTTGAGAGCTGCTGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-991s21c1
Sequence:CCGGATTCCCAGACAGGCAACTATGCTCGAGCATAGTTGCCTGTCTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005216
VALIDATED
DDOST MISSION shRNA shRNA Plasmid DNA
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-1089s1c1
Sequence:CCGGCCCTTTGATGGCGATGACATTCTCGAGAATGTCATCGCCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-1202s1c1
Sequence:CCGGGTATGGTGTATTCCAGTTTAACTCGAGTTAAACTGGAATACACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-270s1c1
Sequence:CCGGCTCACATTCAAGACCGCTGATCTCGAGATCAGCGGTCTTGAATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005216.3-601s1c1
Sequence:CCGGCAACCATCGTTGGGAAATCATCTCGAGATGATTTCCCAACGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005216.3-729s1c1
Sequence:CCGGGACAAGCCTATCACCCAGTATCTCGAGATACTGGGTGATAGGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-421s21c1
Sequence:CCGGTCTATGACAATCTCATCATTTCTCGAGAAATGATGAGATTGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005216.4-822s21c1
Sequence:CCGGGACAAGCCTATCACCCAGTATCTCGAGATACTGGGTGATAGGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005216.4-1695s21c1
Sequence:CCGGTTTCCACTTTGAATTGCTAAACTCGAGTTTAGCAATTCAAAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-1286s21c1
Sequence:CCGGGCCCGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-1149s21c1
Sequence:CCGGGTGATCCAGCAGCTCTCAAATCTCGAGATTTGAGAGCTGCTGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-991s21c1
Sequence:CCGGATTCCCAGACAGGCAACTATGCTCGAGCATAGTTGCCTGTCTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005216
VALIDATED
DDOST MISSION shRNA Lentiviral Transduction Particles
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-1089s1c1
Sequence:CCGGCCCTTTGATGGCGATGACATTCTCGAGAATGTCATCGCCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-1202s1c1
Sequence:CCGGGTATGGTGTATTCCAGTTTAACTCGAGTTAAACTGGAATACACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005216.3-270s1c1
Sequence:CCGGCTCACATTCAAGACCGCTGATCTCGAGATCAGCGGTCTTGAATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005216.3-601s1c1
Sequence:CCGGCAACCATCGTTGGGAAATCATCTCGAGATGATTTCCCAACGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005216.3-729s1c1
Sequence:CCGGGACAAGCCTATCACCCAGTATCTCGAGATACTGGGTGATAGGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-421s21c1
Sequence:CCGGTCTATGACAATCTCATCATTTCTCGAGAAATGATGAGATTGTCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005216.4-822s21c1
Sequence:CCGGGACAAGCCTATCACCCAGTATCTCGAGATACTGGGTGATAGGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005216.4-1695s21c1
Sequence:CCGGTTTCCACTTTGAATTGCTAAACTCGAGTTTAGCAATTCAAAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-1286s21c1
Sequence:CCGGGCCCGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-1149s21c1
Sequence:CCGGGTGATCCAGCAGCTCTCAAATCTCGAGATTTGAGAGCTGCTGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005216.4-991s21c1
Sequence:CCGGATTCCCAGACAGGCAACTATGCTCGAGCATAGTTGCCTGTCTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007838
VALIDATED
DDOST MISSION shRNA Bacterial Glycerol Stock
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1951s1c1
Sequence:CCGGGCAGCTCACAACCTTCTATAACTCGAGTTATAGAAGGTTGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1090s1c1
Sequence:CCGGGAGTATAGCATCATCATAGAACTCGAGTTCTATGATGATGCTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1087s1c1
Sequence:CCGGGTGGAGTATAGCATCATCATACTCGAGTATGATGATGCTATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-676s1c1
Sequence:CCGGCCCATTCTCTTCCGAGGAGTTCTCGAGAACTCCTCGGAAGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1239s1c1
Sequence:CCGGGCCTGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-523s21c1
Sequence:CCGGAGTGAGTGTGGGATTGAATTTCTCGAGAAATTCAATCCCACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007838.2-1639s21c1
Sequence:CCGGTGAATCACTCTGTGGCAATTTCTCGAGAAATTGCCACAGAGTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-676s21c2
Sequence:CCGGCCCATTCTCTTCCGAGGAGTTCTCGAGAACTCCTCGGAAGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-1239s21c2
Sequence:CCGGGCCTGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-1090s21c3
Sequence:CCGGGAGTATAGCATCATCATAGAACTCGAGTTCTATGATGATGCTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007838
VALIDATED
DDOST MISSION shRNA shRNA Plasmid DNA
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1951s1c1
Sequence:CCGGGCAGCTCACAACCTTCTATAACTCGAGTTATAGAAGGTTGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1090s1c1
Sequence:CCGGGAGTATAGCATCATCATAGAACTCGAGTTCTATGATGATGCTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1087s1c1
Sequence:CCGGGTGGAGTATAGCATCATCATACTCGAGTATGATGATGCTATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-676s1c1
Sequence:CCGGCCCATTCTCTTCCGAGGAGTTCTCGAGAACTCCTCGGAAGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1239s1c1
Sequence:CCGGGCCTGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-523s21c1
Sequence:CCGGAGTGAGTGTGGGATTGAATTTCTCGAGAAATTCAATCCCACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007838.2-1639s21c1
Sequence:CCGGTGAATCACTCTGTGGCAATTTCTCGAGAAATTGCCACAGAGTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-676s21c2
Sequence:CCGGCCCATTCTCTTCCGAGGAGTTCTCGAGAACTCCTCGGAAGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-1239s21c2
Sequence:CCGGGCCTGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-1090s21c3
Sequence:CCGGGAGTATAGCATCATCATAGAACTCGAGTTCTATGATGATGCTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007838
VALIDATED
DDOST MISSION shRNA Lentiviral Transduction Particles
dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1951s1c1
Sequence:CCGGGCAGCTCACAACCTTCTATAACTCGAGTTATAGAAGGTTGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1090s1c1
Sequence:CCGGGAGTATAGCATCATCATAGAACTCGAGTTCTATGATGATGCTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1087s1c1
Sequence:CCGGGTGGAGTATAGCATCATCATACTCGAGTATGATGATGCTATACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-676s1c1
Sequence:CCGGCCCATTCTCTTCCGAGGAGTTCTCGAGAACTCCTCGGAAGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007838.2-1239s1c1
Sequence:CCGGGCCTGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-523s21c1
Sequence:CCGGAGTGAGTGTGGGATTGAATTTCTCGAGAAATTCAATCCCACACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007838.2-1639s21c1
Sequence:CCGGTGAATCACTCTGTGGCAATTTCTCGAGAAATTGCCACAGAGTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-676s21c2
Sequence:CCGGCCCATTCTCTTCCGAGGAGTTCTCGAGAACTCCTCGGAAGAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-1239s21c2
Sequence:CCGGGCCTGACGTGTATGGTGTATTCTCGAGAATACACCATACACGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007838.2-1090s21c3
Sequence:CCGGGAGTATAGCATCATCATAGAACTCGAGTTCTATGATGATGCTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks