EMAIL THIS PAGE TO A FRIEND

DDR1

discoidin domain receptor tyrosine kinase 1

Synonyms: CAK CD167 DDR EDDR1 HGK2 MCK10 NEP NTRK4 PTK3 PTK3A RTK6 TRKE
Gene ID:
Human(780) Summary: Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Mouse(12305) discoidin domain receptor family, member 1
Rat(25678) discoidin domain receptor tyrosine kinase 1
Zebrafish(100007346) discoidin domain receptor family, member 1
cow(534092) discoidin domain receptor tyrosine kinase 1
Horse(100050861) discoidin domain receptor tyrosine kinase 1
domestic cat(101096728) discoidin domain receptor tyrosine kinase 1
dog(474832) discoidin domain receptor tyrosine kinase 1
domestic guinea pig(100725492) discoidin domain receptor tyrosine kinase 1
naked mole-rat(101699683) discoidin domain receptor tyrosine kinase 1
sheep(101104279) discoidin domain receptor tyrosine kinase 1
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900058 Anti-DDR1 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution horse, dog, pig, human, monkey, bovine
immunohistochemistry pricing
SAB2900092 Anti-DDR1 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1300850 Anti-DDR1 (center) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, western blot pricing
SAB1300849 Anti-DDR1 (N-term D19) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1405543 Anti-DDR1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1300111 Anti-MCK10 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1300892 Anti-MCK10 antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1307122 ANTI-MCK10 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4504671 Anti-phospho-DDR1 (pTyr513) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301329 Anti-phospho-DDR1 (pTyr513) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB5300117 Monoclonal Anti-DDR1 antibody produced in mouse clone 2G4E12, ascites fluid human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1412 Human DDR1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001954 siRNAs that have been validated in the lab human pricing
NM_013993 Rosetta Predictions human pricing
NM_013994 Rosetta Predictions human pricing
NM_013137 Rosetta Predictions rat pricing
NM_007584 Rosetta Predictions mouse pricing
NM_172962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001954 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165216 validated 2484
1 SASI_Hs01_00165212 validated 578
1 SASI_Hs01_00165211 validated 1392
2 SASI_Hs01_00165213 predicted 1395
3 SASI_Hs01_00165214 predicted 2569
4 SASI_Hs01_00165215 predicted 609
5 SASI_Hs02_00332886 predicted 977
6 SASI_Hs01_00165217 predicted 2577
7 SASI_Hs01_00165218 predicted 2431
8 SASI_Hs01_00165219 predicted 3068
9 SASI_Hs01_00165220 predicted 2568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017864 predicted 1317
2 SASI_Hs01_00017865 predicted 501
3 SASI_Hs01_00017866 predicted 1318
4 SASI_Hs01_00017867 predicted 2615
5 SASI_Hs01_00017868 predicted 533
6 SASI_Hs01_00017869 predicted 2517
7 SASI_Hs02_00344955 predicted 904
8 SASI_Hs01_00017870 predicted 2605
9 SASI_Hs01_00017871 predicted 2472
10 SASI_Hs01_00017872 predicted 3109
11 SASI_Hs01_00017873 predicted 2612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238906 predicted 1105
2 SASI_Hs01_00238907 predicted 284
3 SASI_Hs01_00238908 predicted 1103
4 SASI_Hs01_00238909 predicted 2416
5 SASI_Hs01_00238910 predicted 312
6 SASI_Hs01_00238911 predicted 2316
7 SASI_Hs02_00344956 predicted 687
8 SASI_Hs01_00238912 predicted 2406
9 SASI_Hs01_00238913 predicted 2275
10 SASI_Hs01_00238914 predicted 2904
11 SASI_Hs01_00238915 predicted 2405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084680 predicted 624
2 SASI_Rn01_00084681 predicted 1048
3 SASI_Rn01_00084682 predicted 2340
4 SASI_Rn01_00084683 predicted 1893
5 SASI_Rn01_00084684 predicted 635
6 SASI_Rn01_00084685 predicted 349
7 SASI_Rn01_00084686 predicted 2245
8 SASI_Rn01_00084687 predicted 2243
9 SASI_Rn01_00084688 predicted 2248
10 SASI_Rn01_00084689 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055693 predicted 379
2 SASI_Mm01_00055694 predicted 864
3 SASI_Mm02_00311980 predicted 3081
4 SASI_Mm01_00055695 predicted 2156
5 SASI_Mm01_00055696 predicted 894
6 SASI_Mm01_00055698 predicted 1318
7 SASI_Mm01_00055699 predicted 1018
8 SASI_Mm01_00055701 predicted 601
9 SASI_Mm01_00055702 predicted 2511
10 SASI_Mm02_00311981 predicted 314
11 SASI_Mm01_00055697 predicted 1814
12 SASI_Mm01_00055700 predicted 2227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345002 predicted 379
2 SASI_Mm02_00345003 predicted 866
3 SASI_Mm02_00345004 predicted 2972
4 SASI_Mm02_00345005 predicted 2041
5 SASI_Mm02_00345006 predicted 898
6 SASI_Mm02_00345007 predicted 1324
7 SASI_Mm02_00345008 predicted 1022
8 SASI_Mm02_00345009 predicted 607
9 SASI_Mm02_00345010 predicted 2401
10 SASI_Mm02_00345011 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001954
VALIDATED
DDR1 MISSION shRNA Bacterial Glycerol Stock
discoidin domain receptor tyrosine kinase 1
Human
28 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1355s21c1
Sequence:CCGGGTGTGGCTCGCTTTCTGCAGTCTCGAGACTGCAGAAAGCGAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-390s21c1
Sequence:CCGGTGCTGACATGAAGGGACATTTCTCGAGAAATGTCCCTTCATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-586s21c1
Sequence:CCGGGAGTACTTGCAGGTGGATCTACTCGAGTAGATCCACCTGCAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1397s21c1
Sequence:CCGGCCTGGTTACTCTTCAGCGAAACTCGAGTTTCGCTGAAGAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1182s21c1
Sequence:CCGGGCAGGTCCACTGTAACAACATCTCGAGATGTTGTTACAGTGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001954.3-574s1c1
Sequence:CCGGCCCAAGGAGGAGGAGTACTTGCTCGAGCAAGTACTCCTCCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001954.3-3600s1c1
Sequence:CCGGGTGGAGTAAATATTGGGATTGCTCGAGCAATCCCAATATTTACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001954.3-2858s1c1
Sequence:CCGGGCCTATATGAGCTGATGCTTCCTCGAGGAAGCATCAGCTCATATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.x-961s1c1
Sequence:CCGGTACCTCAACGACTCCACCTATCTCGAGATAGGTGGAGTCGTTGAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-1857s1c1
Sequence:CCGGGGACTATATGGAGCCTGAGAACTCGAGTTCTCAGGCTCCATATAGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-2173s1c1
Sequence:CCGGCTGGTAGCTGTCAAGATCTTACTCGAGTAAGATCTTGACAGCTACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-942s1c1
Sequence:CCGGGTATTTATCTGAGGCCGTGTACTCGAGTACACGGCCTCAGATAAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-960s1c1
Sequence:CCGGGTACCTCAACGACTCCACCTACTCGAGTAGGTGGAGTCGTTGAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-1358s1c1
Sequence:CCGGGTGTGGCTCGCTTTCTGCAGTCTCGAGACTGCAGAAAGCGAGCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1407s1c1
Sequence:CCGGCTTCAGCGAAATCTCCTTCATCTCGAGATGAAGGAGATTTCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-2116s1c1
Sequence:CCGGCCTCAAGATCTGGTTAGTCTTCTCGAGAAGACTAACCAGATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3416s1c1
Sequence:CCGGGAGGACAAGAAGGAGAGGAAACTCGAGTTTCCTCTCCTTCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-586s1c1
Sequence:CCGGGAGTACTTGCAGGTGGATCTACTCGAGTAGATCCACCTGCAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.3-2203s1c1
Sequence:CCGGGCCACCAAGAATGCCAGGAATCTCGAGATTCCTGGCATTCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1182s1c1
Sequence:CCGGGCAGGTCCACTGTAACAACATCTCGAGATGTTGTTACAGTGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.3-2853s1c1
Sequence:CCGGGCAGGGCCTATATGAGCTGATCTCGAGATCAGCTCATATAGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-968s1c1
Sequence:CCGGACTCCACCTATGACGGACATACTCGAGTATGTCCGTCATAGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1397s1c1
Sequence:CCGGCCTGGTTACTCTTCAGCGAAACTCGAGTTTCGCTGAAGAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3587s1c1
Sequence:CCGGCCTATACGTTTCTGTGGAGTACTCGAGTACTCCACAGAAACGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-2024s1c1
Sequence:CCGGCCAGAGTGGATTTCCCTCGATCTCGAGATCGAGGGAAATCCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1422s1c1
Sequence:CCGGCTTCATCTCTGATGTGGTGAACTCGAGTTCACCACATCAGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-390s1c1
Sequence:CCGGTGCTGACATGAAGGGACATTTCTCGAGAAATGTCCCTTCATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3559s1c1
Sequence:CCGGGCAGTCTTGTAGCTAGAACTTCTCGAGAAGTTCTAGCTACAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001954
VALIDATED
DDR1 MISSION shRNA shRNA Plasmid DNA
discoidin domain receptor tyrosine kinase 1
Human
28 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1355s21c1
Sequence:CCGGGTGTGGCTCGCTTTCTGCAGTCTCGAGACTGCAGAAAGCGAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-390s21c1
Sequence:CCGGTGCTGACATGAAGGGACATTTCTCGAGAAATGTCCCTTCATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-586s21c1
Sequence:CCGGGAGTACTTGCAGGTGGATCTACTCGAGTAGATCCACCTGCAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1397s21c1
Sequence:CCGGCCTGGTTACTCTTCAGCGAAACTCGAGTTTCGCTGAAGAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1182s21c1
Sequence:CCGGGCAGGTCCACTGTAACAACATCTCGAGATGTTGTTACAGTGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001954.3-574s1c1
Sequence:CCGGCCCAAGGAGGAGGAGTACTTGCTCGAGCAAGTACTCCTCCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001954.3-3600s1c1
Sequence:CCGGGTGGAGTAAATATTGGGATTGCTCGAGCAATCCCAATATTTACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001954.3-2858s1c1
Sequence:CCGGGCCTATATGAGCTGATGCTTCCTCGAGGAAGCATCAGCTCATATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.x-961s1c1
Sequence:CCGGTACCTCAACGACTCCACCTATCTCGAGATAGGTGGAGTCGTTGAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-1857s1c1
Sequence:CCGGGGACTATATGGAGCCTGAGAACTCGAGTTCTCAGGCTCCATATAGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-2173s1c1
Sequence:CCGGCTGGTAGCTGTCAAGATCTTACTCGAGTAAGATCTTGACAGCTACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-942s1c1
Sequence:CCGGGTATTTATCTGAGGCCGTGTACTCGAGTACACGGCCTCAGATAAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-960s1c1
Sequence:CCGGGTACCTCAACGACTCCACCTACTCGAGTAGGTGGAGTCGTTGAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-1358s1c1
Sequence:CCGGGTGTGGCTCGCTTTCTGCAGTCTCGAGACTGCAGAAAGCGAGCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1407s1c1
Sequence:CCGGCTTCAGCGAAATCTCCTTCATCTCGAGATGAAGGAGATTTCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-2116s1c1
Sequence:CCGGCCTCAAGATCTGGTTAGTCTTCTCGAGAAGACTAACCAGATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3416s1c1
Sequence:CCGGGAGGACAAGAAGGAGAGGAAACTCGAGTTTCCTCTCCTTCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-586s1c1
Sequence:CCGGGAGTACTTGCAGGTGGATCTACTCGAGTAGATCCACCTGCAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.3-2203s1c1
Sequence:CCGGGCCACCAAGAATGCCAGGAATCTCGAGATTCCTGGCATTCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1182s1c1
Sequence:CCGGGCAGGTCCACTGTAACAACATCTCGAGATGTTGTTACAGTGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.3-2853s1c1
Sequence:CCGGGCAGGGCCTATATGAGCTGATCTCGAGATCAGCTCATATAGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-968s1c1
Sequence:CCGGACTCCACCTATGACGGACATACTCGAGTATGTCCGTCATAGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1397s1c1
Sequence:CCGGCCTGGTTACTCTTCAGCGAAACTCGAGTTTCGCTGAAGAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3587s1c1
Sequence:CCGGCCTATACGTTTCTGTGGAGTACTCGAGTACTCCACAGAAACGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-2024s1c1
Sequence:CCGGCCAGAGTGGATTTCCCTCGATCTCGAGATCGAGGGAAATCCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1422s1c1
Sequence:CCGGCTTCATCTCTGATGTGGTGAACTCGAGTTCACCACATCAGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-390s1c1
Sequence:CCGGTGCTGACATGAAGGGACATTTCTCGAGAAATGTCCCTTCATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3559s1c1
Sequence:CCGGGCAGTCTTGTAGCTAGAACTTCTCGAGAAGTTCTAGCTACAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001954
VALIDATED
DDR1 MISSION shRNA Lentiviral Transduction Particles
discoidin domain receptor tyrosine kinase 1
Human
28 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1355s21c1
Sequence:CCGGGTGTGGCTCGCTTTCTGCAGTCTCGAGACTGCAGAAAGCGAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-390s21c1
Sequence:CCGGTGCTGACATGAAGGGACATTTCTCGAGAAATGTCCCTTCATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-586s21c1
Sequence:CCGGGAGTACTTGCAGGTGGATCTACTCGAGTAGATCCACCTGCAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1397s21c1
Sequence:CCGGCCTGGTTACTCTTCAGCGAAACTCGAGTTTCGCTGAAGAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001954.4-1182s21c1
Sequence:CCGGGCAGGTCCACTGTAACAACATCTCGAGATGTTGTTACAGTGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001954.3-574s1c1
Sequence:CCGGCCCAAGGAGGAGGAGTACTTGCTCGAGCAAGTACTCCTCCTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001954.3-3600s1c1
Sequence:CCGGGTGGAGTAAATATTGGGATTGCTCGAGCAATCCCAATATTTACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001954.3-2858s1c1
Sequence:CCGGGCCTATATGAGCTGATGCTTCCTCGAGGAAGCATCAGCTCATATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.x-961s1c1
Sequence:CCGGTACCTCAACGACTCCACCTATCTCGAGATAGGTGGAGTCGTTGAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-1857s1c1
Sequence:CCGGGGACTATATGGAGCCTGAGAACTCGAGTTCTCAGGCTCCATATAGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-2173s1c1
Sequence:CCGGCTGGTAGCTGTCAAGATCTTACTCGAGTAAGATCTTGACAGCTACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-942s1c1
Sequence:CCGGGTATTTATCTGAGGCCGTGTACTCGAGTACACGGCCTCAGATAAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-960s1c1
Sequence:CCGGGTACCTCAACGACTCCACCTACTCGAGTAGGTGGAGTCGTTGAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.x-1358s1c1
Sequence:CCGGGTGTGGCTCGCTTTCTGCAGTCTCGAGACTGCAGAAAGCGAGCCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1407s1c1
Sequence:CCGGCTTCAGCGAAATCTCCTTCATCTCGAGATGAAGGAGATTTCGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-2116s1c1
Sequence:CCGGCCTCAAGATCTGGTTAGTCTTCTCGAGAAGACTAACCAGATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3416s1c1
Sequence:CCGGGAGGACAAGAAGGAGAGGAAACTCGAGTTTCCTCTCCTTCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-586s1c1
Sequence:CCGGGAGTACTTGCAGGTGGATCTACTCGAGTAGATCCACCTGCAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.3-2203s1c1
Sequence:CCGGGCCACCAAGAATGCCAGGAATCTCGAGATTCCTGGCATTCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1182s1c1
Sequence:CCGGGCAGGTCCACTGTAACAACATCTCGAGATGTTGTTACAGTGGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001954.3-2853s1c1
Sequence:CCGGGCAGGGCCTATATGAGCTGATCTCGAGATCAGCTCATATAGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-968s1c1
Sequence:CCGGACTCCACCTATGACGGACATACTCGAGTATGTCCGTCATAGGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1397s1c1
Sequence:CCGGCCTGGTTACTCTTCAGCGAAACTCGAGTTTCGCTGAAGAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3587s1c1
Sequence:CCGGCCTATACGTTTCTGTGGAGTACTCGAGTACTCCACAGAAACGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-2024s1c1
Sequence:CCGGCCAGAGTGGATTTCCCTCGATCTCGAGATCGAGGGAAATCCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-1422s1c1
Sequence:CCGGCTTCATCTCTGATGTGGTGAACTCGAGTTCACCACATCAGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-390s1c1
Sequence:CCGGTGCTGACATGAAGGGACATTTCTCGAGAAATGTCCCTTCATGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001954.3-3559s1c1
Sequence:CCGGGCAGTCTTGTAGCTAGAACTTCTCGAGAAGTTCTAGCTACAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007584
VALIDATED
DDR1 MISSION shRNA Bacterial Glycerol Stock
discoidin domain receptor tyrosine kinase 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-1345s21c1
Sequence:CCGGGAGATCTCTTTCATCTCAGATCTCGAGATCTGAGATGAAAGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-898s21c1
Sequence:CCGGGATTCCACTTACGATGGATATCTCGAGATATCCATCGTAAGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-2524s21c1
Sequence:CCGGGCCACGCTGAACTTTGTGCATCTCGAGATGCACAAAGTTCAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007584.2-3084s21c1
Sequence:CCGGCGTCTCCATACTTGCCCATTCCTCGAGGAATGGGCAAGTATGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007584.1-746s1c1
Sequence:CCGGGATTCCACTTACGATGGATATCTCGAGATATCCATCGTAAGTGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007584.1-2372s1c1
Sequence:CCGGGCCACGCTGAACTTTGTGCATCTCGAGATGCACAAAGTTCAGCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007584
VALIDATED
DDR1 MISSION shRNA shRNA Plasmid DNA
discoidin domain receptor tyrosine kinase 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-1345s21c1
Sequence:CCGGGAGATCTCTTTCATCTCAGATCTCGAGATCTGAGATGAAAGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-898s21c1
Sequence:CCGGGATTCCACTTACGATGGATATCTCGAGATATCCATCGTAAGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-2524s21c1
Sequence:CCGGGCCACGCTGAACTTTGTGCATCTCGAGATGCACAAAGTTCAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007584.2-3084s21c1
Sequence:CCGGCGTCTCCATACTTGCCCATTCCTCGAGGAATGGGCAAGTATGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007584.1-746s1c1
Sequence:CCGGGATTCCACTTACGATGGATATCTCGAGATATCCATCGTAAGTGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007584.1-2372s1c1
Sequence:CCGGGCCACGCTGAACTTTGTGCATCTCGAGATGCACAAAGTTCAGCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007584
VALIDATED
DDR1 MISSION shRNA Lentiviral Transduction Particles
discoidin domain receptor tyrosine kinase 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-1345s21c1
Sequence:CCGGGAGATCTCTTTCATCTCAGATCTCGAGATCTGAGATGAAAGAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-898s21c1
Sequence:CCGGGATTCCACTTACGATGGATATCTCGAGATATCCATCGTAAGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007584.2-2524s21c1
Sequence:CCGGGCCACGCTGAACTTTGTGCATCTCGAGATGCACAAAGTTCAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007584.2-3084s21c1
Sequence:CCGGCGTCTCCATACTTGCCCATTCCTCGAGGAATGGGCAAGTATGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007584.1-746s1c1
Sequence:CCGGGATTCCACTTACGATGGATATCTCGAGATATCCATCGTAAGTGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007584.1-2372s1c1
Sequence:CCGGGCCACGCTGAACTTTGTGCATCTCGAGATGCACAAAGTTCAGCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks