EMAIL THIS PAGE TO A FRIEND

DDR2

discoidin domain receptor tyrosine kinase 2

100 Gene Product Result for
Synonyms: MIG20a NTRKR3 TKT TYRO10
UniProtKB ID: Q16832, Q7Z730
Gene ID:
Human(4921) Summary: Receptor tyrosine kinases (RTKs) play a key role in the communication of cells with their microenvironment. These molecules are involved in the regulation of cell growth, differentiation, and metabolism. In several cases the biochemical mechanism by which RTKs transduce signals across the membrane has been shown to be ligand induced receptor oligomerization and subsequent intracellular phosphorylation. This autophosphorylation leads to phosphorylation of cytosolic targets as well as association with other molecules, which are involved in pleiotropic effects of signal transduction. RTKs have a tripartite structure with extracellular, transmembrane, and cytoplasmic regions. This gene encodes a member of a novel subclass of RTKs and contains a distinct extracellular region encompassing a factor VIII-like domain. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(18214) discoidin domain receptor family, member 2
Rat(685781) discoidin domain receptor tyrosine kinase 2
Zebrafish(559428) discoidin domain receptor family, member 2
dog(478987) discoidin domain receptor tyrosine kinase 2
chicken(396404) discoidin domain receptor tyrosine kinase 2
Horse(100058300) discoidin domain receptor tyrosine kinase 2
cow(533523) discoidin domain receptor tyrosine kinase 2
domestic cat(101085267) discoidin domain receptor tyrosine kinase 2
sheep(101109754) discoidin domain receptor tyrosine kinase 2
naked mole-rat(101712349) discoidin domain receptor tyrosine kinase 2
domestic guinea pig(100729537) discoidin domain receptor tyrosine kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014796 Rosetta Predictions human pricing
NM_006182 Rosetta Predictions human pricing
NM_031764 Rosetta Predictions rat pricing
NM_022563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022152 predicted 1497
2 SASI_Hs01_00022153 predicted 2022
3 SASI_Hs02_00306567 predicted 1137
4 SASI_Hs01_00022154 predicted 1862
5 SASI_Hs01_00022155 predicted 1261
6 SASI_Hs02_00306568 predicted 2964
7 SASI_Hs01_00022157 predicted 2490
8 SASI_Hs01_00022158 predicted 2499
9 SASI_Hs02_00306569 predicted 2733
10 SASI_Hs01_00022159 predicted 994
11 SASI_Hs01_00022156 predicted 1334
12 SASI_Hs01_00022160 predicted 2624
13 SASI_Hs01_00022161 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124159 predicted 1410
2 SASI_Hs01_00124160 predicted 1940
3 SASI_Hs02_00341050 predicted 1051
4 SASI_Hs01_00124161 predicted 1787
5 SASI_Hs01_00124162 predicted 1184
6 SASI_Hs02_00341051 predicted 2890
7 SASI_Hs01_00124164 predicted 2413
8 SASI_Hs01_00124165 predicted 2424
9 SASI_Hs02_00341052 predicted 2649
10 SASI_Hs01_00124166 predicted 909
11 SASI_Hs01_00124163 predicted 1251
12 SASI_Hs01_00124167 predicted 2544
13 SASI_Hs01_00124168 predicted 2459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265183 predicted 1568
2 SASI_Rn02_00265184 predicted 2121
3 SASI_Rn02_00265185 predicted 2011
4 SASI_Rn02_00265186 predicted 2074
5 SASI_Rn02_00265187 predicted 1397
6 SASI_Rn02_00265188 predicted 1771
7 SASI_Rn02_00265189 predicted 1918
8 SASI_Rn02_00265190 predicted 329
9 SASI_Rn02_00265191 predicted 1554
10 SASI_Rn02_00265192 predicted 1843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106702 predicted 2318
2 SASI_Mm01_00106703 predicted 1573
3 SASI_Mm01_00106704 predicted 600
4 SASI_Mm01_00106705 predicted 1206
5 SASI_Mm01_00106706 predicted 2334
6 SASI_Mm01_00106707 predicted 2087
7 SASI_Mm01_00106708 predicted 1019
8 SASI_Mm01_00106709 predicted 2246
9 SASI_Mm01_00106710 predicted 499
10 SASI_Mm02_00326623 predicted 428
11 SASI_Mm01_00106701 predicted 2749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006182
DDR2 MISSION shRNA Bacterial Glycerol Stock
discoidin domain receptor tyrosine kinase 2
Human
23 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-2970s1c1
Sequence:CCGGCCATGTTCCTACGGCTCAGGTCTCGAGACCTGAGCCGTAGGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-950s1c1
Sequence:CCGGGATGGCTTGGTGTCTTACAATCTCGAGATTGTAAGACACCAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-3004s1c1
Sequence:CCGGCCTACCACTCACCCATGCCTACTCGAGTAGGCATGGGTGAGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1180s1c1
Sequence:CCGGCAATGGCTACATTGAGATCATCTCGAGATGATCTCAATGTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1258s1c1
Sequence:CCGGGTTTGCTAAAGGTGTGAAGATCTCGAGATCTTCACACCTTTAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-898s1c1
Sequence:CCGGCCACTCCATGAATGTGTGTATCTCGAGATACACACATTCATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1733s1c1
Sequence:CCGGGATTCTAGCATGTTCAACAATCTCGAGATTGTTGAACATGCTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1419s1c1
Sequence:CCGGCCATCAAGTGTCAATACCATTCTCGAGAATGGTATTGACACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-997s1c1
Sequence:CCGGCCCTGGAGGTTCCATCATTTACTCGAGTAAATGATGGAACCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2298s1c1
Sequence:CCGGTCCATCTATTAGCTGTGTGTACTCGAGTACACACAGCTAATAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2287s1c1
Sequence:CCGGCCCAAACATCATCCATCTATTCTCGAGAATAGATGGATGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2899s1c1
Sequence:CCGGCCGTCCCTCATTCCAAGAAATCTCGAGATTTCTTGGAATGAGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-3015s1c1
Sequence:CCGGCCCATGCCTATGCCACTCCATCTCGAGATGGAGTGGCATAGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2758s1c1
Sequence:CCGGGCTGTCAGATGAACAGGTTATCTCGAGATAACCTGTTCATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-2193s1c1
Sequence:CCGGGCCAACAAGAATGCCAGGAATCTCGAGATTCCTGGCATTCTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-834s1c1
Sequence:CCGGGCCAGATTTGTCCGGTTCATTCTCGAGAATGAACCGGACAAATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-1694s1c1
Sequence:CCGGGCCAAGTGATTCTAGCATGTTCTCGAGAACATGCTAGAATCACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-1923s1c1
Sequence:CCGGGCTGACATAGTGAACCTCCAACTCGAGTTGGAGGTTCACTATGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-421s1c1
Sequence:CCGGCTCAGGTTAATCCAGCTATATCTCGAGATATAGCTGGATTAACCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006182.2-2983s1c1
Sequence:CCGGGCTCAGGTCCTCCCTACAAGACTCGAGTCTTGTAGGGAGGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-2482s1c1
Sequence:CCGGGTACCTTTCCTCTCTTAATTTCTCGAGAAATTAAGAGAGGAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-731s1c1
Sequence:CCGGCCCATGTACAAGATCAATTACCTCGAGGTAATTGATCTTGTACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-2525s1c1
Sequence:CCGGCGAAACTGTTTAGTGGGTAAGCTCGAGCTTACCCACTAAACAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006182
DDR2 MISSION shRNA shRNA Plasmid DNA
discoidin domain receptor tyrosine kinase 2
Human
23 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-2970s1c1
Sequence:CCGGCCATGTTCCTACGGCTCAGGTCTCGAGACCTGAGCCGTAGGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-950s1c1
Sequence:CCGGGATGGCTTGGTGTCTTACAATCTCGAGATTGTAAGACACCAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-3004s1c1
Sequence:CCGGCCTACCACTCACCCATGCCTACTCGAGTAGGCATGGGTGAGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1180s1c1
Sequence:CCGGCAATGGCTACATTGAGATCATCTCGAGATGATCTCAATGTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1258s1c1
Sequence:CCGGGTTTGCTAAAGGTGTGAAGATCTCGAGATCTTCACACCTTTAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-898s1c1
Sequence:CCGGCCACTCCATGAATGTGTGTATCTCGAGATACACACATTCATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1733s1c1
Sequence:CCGGGATTCTAGCATGTTCAACAATCTCGAGATTGTTGAACATGCTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1419s1c1
Sequence:CCGGCCATCAAGTGTCAATACCATTCTCGAGAATGGTATTGACACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-997s1c1
Sequence:CCGGCCCTGGAGGTTCCATCATTTACTCGAGTAAATGATGGAACCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2298s1c1
Sequence:CCGGTCCATCTATTAGCTGTGTGTACTCGAGTACACACAGCTAATAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2287s1c1
Sequence:CCGGCCCAAACATCATCCATCTATTCTCGAGAATAGATGGATGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2899s1c1
Sequence:CCGGCCGTCCCTCATTCCAAGAAATCTCGAGATTTCTTGGAATGAGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-3015s1c1
Sequence:CCGGCCCATGCCTATGCCACTCCATCTCGAGATGGAGTGGCATAGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2758s1c1
Sequence:CCGGGCTGTCAGATGAACAGGTTATCTCGAGATAACCTGTTCATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-2193s1c1
Sequence:CCGGGCCAACAAGAATGCCAGGAATCTCGAGATTCCTGGCATTCTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-834s1c1
Sequence:CCGGGCCAGATTTGTCCGGTTCATTCTCGAGAATGAACCGGACAAATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-1694s1c1
Sequence:CCGGGCCAAGTGATTCTAGCATGTTCTCGAGAACATGCTAGAATCACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-1923s1c1
Sequence:CCGGGCTGACATAGTGAACCTCCAACTCGAGTTGGAGGTTCACTATGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-421s1c1
Sequence:CCGGCTCAGGTTAATCCAGCTATATCTCGAGATATAGCTGGATTAACCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006182.2-2983s1c1
Sequence:CCGGGCTCAGGTCCTCCCTACAAGACTCGAGTCTTGTAGGGAGGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-2482s1c1
Sequence:CCGGGTACCTTTCCTCTCTTAATTTCTCGAGAAATTAAGAGAGGAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-731s1c1
Sequence:CCGGCCCATGTACAAGATCAATTACCTCGAGGTAATTGATCTTGTACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-2525s1c1
Sequence:CCGGCGAAACTGTTTAGTGGGTAAGCTCGAGCTTACCCACTAAACAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006182
DDR2 MISSION shRNA Lentiviral Transduction Particles
discoidin domain receptor tyrosine kinase 2
Human
23 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-2970s1c1
Sequence:CCGGCCATGTTCCTACGGCTCAGGTCTCGAGACCTGAGCCGTAGGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-950s1c1
Sequence:CCGGGATGGCTTGGTGTCTTACAATCTCGAGATTGTAAGACACCAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-3004s1c1
Sequence:CCGGCCTACCACTCACCCATGCCTACTCGAGTAGGCATGGGTGAGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1180s1c1
Sequence:CCGGCAATGGCTACATTGAGATCATCTCGAGATGATCTCAATGTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1258s1c1
Sequence:CCGGGTTTGCTAAAGGTGTGAAGATCTCGAGATCTTCACACCTTTAGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-898s1c1
Sequence:CCGGCCACTCCATGAATGTGTGTATCTCGAGATACACACATTCATGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1733s1c1
Sequence:CCGGGATTCTAGCATGTTCAACAATCTCGAGATTGTTGAACATGCTAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-1419s1c1
Sequence:CCGGCCATCAAGTGTCAATACCATTCTCGAGAATGGTATTGACACTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-997s1c1
Sequence:CCGGCCCTGGAGGTTCCATCATTTACTCGAGTAAATGATGGAACCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2298s1c1
Sequence:CCGGTCCATCTATTAGCTGTGTGTACTCGAGTACACACAGCTAATAGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2287s1c1
Sequence:CCGGCCCAAACATCATCCATCTATTCTCGAGAATAGATGGATGATGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2899s1c1
Sequence:CCGGCCGTCCCTCATTCCAAGAAATCTCGAGATTTCTTGGAATGAGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006182.2-3015s1c1
Sequence:CCGGCCCATGCCTATGCCACTCCATCTCGAGATGGAGTGGCATAGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.2-2758s1c1
Sequence:CCGGGCTGTCAGATGAACAGGTTATCTCGAGATAACCTGTTCATCTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-2193s1c1
Sequence:CCGGGCCAACAAGAATGCCAGGAATCTCGAGATTCCTGGCATTCTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-834s1c1
Sequence:CCGGGCCAGATTTGTCCGGTTCATTCTCGAGAATGAACCGGACAAATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-1694s1c1
Sequence:CCGGGCCAAGTGATTCTAGCATGTTCTCGAGAACATGCTAGAATCACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-1923s1c1
Sequence:CCGGGCTGACATAGTGAACCTCCAACTCGAGTTGGAGGTTCACTATGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006182.x-421s1c1
Sequence:CCGGCTCAGGTTAATCCAGCTATATCTCGAGATATAGCTGGATTAACCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006182.2-2983s1c1
Sequence:CCGGGCTCAGGTCCTCCCTACAAGACTCGAGTCTTGTAGGGAGGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-2482s1c1
Sequence:CCGGGTACCTTTCCTCTCTTAATTTCTCGAGAAATTAAGAGAGGAAAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-731s1c1
Sequence:CCGGCCCATGTACAAGATCAATTACCTCGAGGTAATTGATCTTGTACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006182.2-2525s1c1
Sequence:CCGGCGAAACTGTTTAGTGGGTAAGCTCGAGCTTACCCACTAAACAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022563
VALIDATED
DDR2 MISSION shRNA Bacterial Glycerol Stock
discoidin domain receptor tyrosine kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-1638s1c1
Sequence:CCGGCCACCTATGATCCCATGCTTACTCGAGTAAGCATGGGATCATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-2387s1c1
Sequence:CCGGCCAAACATCATCCGTCTCTTACTCGAGTAAGAGACGGATGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022563.1-964s1c1
Sequence:CCGGCGCCAGATTTGTTCGCCTTATCTCGAGATAAGGCGAACAAATCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022563.1-2564s1c1
Sequence:CCGGGCCTCTGGTATGAAGTACCTTCTCGAGAAGGTACTTCATACCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-1173s1c1
Sequence:CCGGGCCAGTTGACTGATGGAGTATCTCGAGATACTCCATCAGTCAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-446s21c1
Sequence:CCGGACTTGCGAACCCTACACTTTACTCGAGTAAAGTGTAGGGTTCGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-2911s21c1
Sequence:CCGGCCCTACTATTGACTCATATATCTCGAGATATATGAGTCAATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-2145s21c1
Sequence:CCGGCATGGAGAATGGAGATCTTAACTCGAGTTAAGATCTCCATTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-3029s21c1
Sequence:CCGGAGACTAGAAACTCAGATAATTCTCGAGAATTATCTGAGTTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022563
VALIDATED
DDR2 MISSION shRNA shRNA Plasmid DNA
discoidin domain receptor tyrosine kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-1638s1c1
Sequence:CCGGCCACCTATGATCCCATGCTTACTCGAGTAAGCATGGGATCATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-2387s1c1
Sequence:CCGGCCAAACATCATCCGTCTCTTACTCGAGTAAGAGACGGATGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022563.1-964s1c1
Sequence:CCGGCGCCAGATTTGTTCGCCTTATCTCGAGATAAGGCGAACAAATCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022563.1-2564s1c1
Sequence:CCGGGCCTCTGGTATGAAGTACCTTCTCGAGAAGGTACTTCATACCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-1173s1c1
Sequence:CCGGGCCAGTTGACTGATGGAGTATCTCGAGATACTCCATCAGTCAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-446s21c1
Sequence:CCGGACTTGCGAACCCTACACTTTACTCGAGTAAAGTGTAGGGTTCGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-2911s21c1
Sequence:CCGGCCCTACTATTGACTCATATATCTCGAGATATATGAGTCAATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-2145s21c1
Sequence:CCGGCATGGAGAATGGAGATCTTAACTCGAGTTAAGATCTCCATTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-3029s21c1
Sequence:CCGGAGACTAGAAACTCAGATAATTCTCGAGAATTATCTGAGTTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022563
VALIDATED
DDR2 MISSION shRNA Lentiviral Transduction Particles
discoidin domain receptor tyrosine kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-1638s1c1
Sequence:CCGGCCACCTATGATCCCATGCTTACTCGAGTAAGCATGGGATCATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-2387s1c1
Sequence:CCGGCCAAACATCATCCGTCTCTTACTCGAGTAAGAGACGGATGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022563.1-964s1c1
Sequence:CCGGCGCCAGATTTGTTCGCCTTATCTCGAGATAAGGCGAACAAATCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022563.1-2564s1c1
Sequence:CCGGGCCTCTGGTATGAAGTACCTTCTCGAGAAGGTACTTCATACCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022563.1-1173s1c1
Sequence:CCGGGCCAGTTGACTGATGGAGTATCTCGAGATACTCCATCAGTCAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-446s21c1
Sequence:CCGGACTTGCGAACCCTACACTTTACTCGAGTAAAGTGTAGGGTTCGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-2911s21c1
Sequence:CCGGCCCTACTATTGACTCATATATCTCGAGATATATGAGTCAATAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-2145s21c1
Sequence:CCGGCATGGAGAATGGAGATCTTAACTCGAGTTAAGATCTCCATTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022563.2-3029s21c1
Sequence:CCGGAGACTAGAAACTCAGATAATTCTCGAGAATTATCTGAGTTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks